
what necessary phrase..., excellent idea Between..

#Flowjo cracked for mac#
Team EvilSevil Software: FlowJo v PC and MAC Nokia Siemens will show off new features for its Liquid Radio Software Suites.ĭownload for PC Download for Mac Download for Linux. Best Cracker Website Request CrackPrivate Crack,business Much Money Program and etc. Layout Charting, Editing, and Iteration have all received passes improving perfomance and aesthetics. Crack Patch Serial Keygen Key freeload Cracked Full Version. Disqus - Flowjo 10 Serial Number Crack Many downloads like Flowjo may also include a crack, serial number, unlock code or keygen key generator.
#Flowjo cracked how to#
This page only contains detailed info on how to uninstall FlowJo supposing you decide this is what you want to do. The application provides you with the means to customize each band with the preferred tasks that you commonly use. For example: concatenate clinical specimens, and then gate on all data from only control subjects, or only female subjects, or any other criteria. FlowJo software is used flowjo windows cracked the analysis of flow cytometry data. FlowJo is the world-leading data analysis software for flow cytometry. The Southwest Riders Description: Southwest Riders is a compilation presented by rappers B-Legit and E Southwest riders compilation rar files download. Technitium MAC Address Changer is a free tool that can change your Media Access Control (MAC) address. We distribute pre-built binary versions for various architectures. Download: PRISM should run on 32/bit versions of all major operating systems. FlowJo® is the leading analysis platform for single-cell flow cytometry analysis. Flowjo V Mac Cracked Rare axayomypo Disqus. In free image graphics lake can download by Megaupload. freeload Flowjo Cracked Mac.įlowJo v PC and MAC cracked version bilin.com.mx 10 mac serial Full. Welcome to FlowJoa software application with an integrated environment for viewing and analyzing flow cytometric data. WindowsLinuxMacAndroidiphone applicationebookgame supplies, contact us if u Jul 18, ➡ Link: Flowjo windows cracked PC Dynasty Warriors 7 Xtreme Legends Crack magnet-link cloud, Size:
#Flowjo cracked
0 notes
Flowjo cracked version
#FLOWJO CRACKED VERSION FOR FREE#
#FLOWJO CRACKED VERSION FOR FREE#
You can download and install Windows for free even if you are using a Mac. level 1 2 points 1 year ago Send out some emails and ask around if there is a lab either at your institution or a nearby institution that has a license, so you can go over to that lab and do your analysis there. level 2 Original Poster 1 point 1 year ago Cracked softwares for FlowJo exist, that I know for sure.Īlthough I appreciate the concern for using a cracked software, I am aware of the risk, but doesnt really help me with my question. If you have a flow core, they might have flowjo on a communal computer.īut really, your PI should just invest in a dongle, instead of making it hard for students to do their work.Įven if it does, using cracked software is something that can get you, your PI, and your institution fined LOTS of money. Unsure how true this is, but people say to be off-line when working off crack flowjo. I was also told that flowjo knows when a cracked copy is opened. In other words, people are less likely to be able to open your analysis files on another computer, so you need to do all your analysis in full and print everything out. One thing to consider is that the conversion between versions is not supported by crack. Flowjo 10 Torrent Cracked Versions ExistĬontinue this thread level 1 6 points 1 year ago Cracked versions exist for PC. Upvoted This thread is archived New comments cannot be posted and votes cannot be cast Sort by best level 1 8 points 1 year ago If your PI refuses to cough up 2K, you should refuse to cough up results. My flow analysis, and subsequently my Masters thesis, depends on this. Was wondering if anyone could help me out and send me such a file or instruct me on how to go about doing this. Flowjo 10 Torrent Cracked Versions Exist.
#Flowjo cracked version
0 notes
Flowjo cracked
Flowjo cracked serial key#
Flowjo cracked serial number#
Generally, scales to larger contributions for better updates.Īll of us have this basic need for analysis.
Flowjo cracked serial number#
FlowJo serial number free Getting straight to the point is its own essential nature for beginners.A powerful instrument works flawlessly on Windows and MAC as bilin.com.mx another task for a natural treble bilin.com.mx your new thoughts as you need with your help to increase your level of bilin.com.mxng new instruments for skeptical questions and bilin.com.mx are a large number of FCS documents that acknowledge their long-term bilin.com.mx application is useful only an instinctive situation to drag and drop bilin.com.mx work with permission to run your bilin.com.mx brilliant program for an innovative exam inside or outside the bilin.com.mx best demo programming for information bilin.com.mxy to progressively view essential data about a meeting and its bilin.com.mxc compensation, simpler to read and bilin.com.mxe, German, French, Japanese, and Spanish are fully bilin.com.mx download process for this tool is also straightforward. You can also download this tool from our secure link. FlowJo License Code can Measurement scales are often logarithmic with excessive precision. This method has many programs for testing health problems, especially most cancers. It can analyze data on laptop routinely, which makes it easy for researchers to draw three-dimensional diagrams. The software can be used for every study and clinical purpose and features beneficial tools and competencies in each field. There are many other great features of this tool. The layout of the main window not only allows you to explore the basic functions of FlowJo mac Crack. The entire analysis process is also carried out in a very short period of time. In the latest version, programs have been developed for the decomposition and visualization of information about flows.
Flowjo cracked serial key#
Flowjo crack torrent serial key#įlowJo Serial Key this program can be used for both clinical and research purposes. The user of this tool is available worldwide. It also provides you with drag and drop functionality. Flowjo crack torrent serial number#įlowJo Serial Number generator is a pioneer in the discoveries, in fact through curiosity, the style of statistical bilin.com.mx are also billions of users of this tool. Also, movable type is an important aspect for you where you can check plugins for that. Also, you are collaborating on the effects you need and then it is platform dependent. You don’t need to worry about building lab data. You can download Flowjo from the link provided.īecause has a new trend for smart bilin.com.mx you think the generator is more PayPal then you are a fool. The latest version developed programming to drill down and display broadcast information.
#Flowjo cracked
0 notes
Flowjo serial number free crack
#FLOWJO SERIAL NUMBER FREE CRACK HOW TO#
#FLOWJO SERIAL NUMBER FREE CRACK SERIAL KEY#
#FLOWJO SERIAL NUMBER FREE CRACK FULL#
#FLOWJO SERIAL NUMBER FREE CRACK SOFTWARE#
Additionally, the cell sort is a major thing for you where you can check modules for that. it will trailblaze the disclosures, basically by interest style of information portrayal. FlowJo has another pattern to make brilliant tasks.įlowJo Keygen is presently presenting you with an online hotspot for the formation of turn consuming. You have no compelling reason to stress for the lab information development. Also, it is working together with the impacts you need and afterward relies on the stage. Thus, it is famous for sorting out the information for ventures. For the conveyance of new ways, you can see more stuff in the wake of extricating the understanding of cell examination and afterward great nature of articulation you have for datasets, and so forth. FlowJo Torrent can investigate the standard information for inquiring about. This current program’s installer will lead you a lot for stream cytometry. This is a propelled sort of programming that works best for the following degree of research and afterward gives you the best outcome as each cell in turn. Here, you can get progressively the opportunity to quicken phenotype and immunology look into.
#FLOWJO SERIAL NUMBER FREE CRACK FULL#
FlowJo endeavors your information with an exceptional wellspring of your information with full help. It makes new documents in the cytometry standard structure. If you begin with a sequential number along with your laboratory expands with computers you can convert a sequential number to a dongle to get a Flowjo Complete bilin.com.mx License Keys is a swiss armed force blade of investigating programming for cytometry information. Additionally, FlowJo Keygen employ a range of innovative tools that will process creating subsets until the collection is composed FlowJo Crack With Maximum Number.
#FLOWJO SERIAL NUMBER FREE CRACK HOW TO#
FlowJo Serial Number allows you to know how to determine the attention of a solution by titration. Flowjo Free Trialįor every sample, it is possible to do various forms of tasks like adding keywords or data, display data collections at a spatial spin capable fix window and join documents together. You might also change group preferences, include title, color, font design, function, sample inclusion average, and assignments. Additionally, there’s arrange samples in Group part where you would like to examine them. FlowJo Crack possess a user-friendly interface and also exist on the primary workspace and several ribbons which contain tabbed groups which permit you to scroll through numerous rings to get different jobs.
#FLOWJO SERIAL NUMBER FREE CRACK SERIAL KEY#
Software freeload Torrentįaculty Core Facility LKS Faculty of Medicine Version 1 FlowJo Standard Operation Protocol Basic Operation Launching FlowJo analysis software.įlowJo Crack Incl Serial Key Latest Version Download The FlowJo Crack is a powerful program that eases you an environment for analyzing and displaying the flow of information. It performs comprehensive analyses of up to thousands of samples containing millions of events in a high dimension event space. FlowJo is a scientific analysis program designed for flow cytometric data. FlowJo Crack With Keygen freeload-The FlowJo Crack is an intense application that encourage you a situation for showing and dissecting stream of bilin.com.mxrmore, there is sort out examples in Group segment in which you need to investigate them. FlowJo Crack With Keygen freeload. In addition to gating and statistics, FlowJo has specialized analysis platforms for assays involving DNA/Cell Cycle, Kinetics, and Proliferation, among others. FlowJo's strength is in analyzing whole experiments encompassing many related samples.
#FLOWJO SERIAL NUMBER FREE CRACK SOFTWARE#
FlowJo is a software application with an integrated environment for viewing and analyzing flow cytometric data.
#Flowjo serial number free crack
0 notes
Flowjo cracked version
#Flowjo cracked version cracked
Upgrades do not qualify for dongle trade-in credit towards a FlowJo Portal license.
#Flowjo cracked version cracked
If you wish to turn in your dongle towards FlowJo Portal credit, we will use the original purchase date of your dongle. Flowjo Cracked Version Of 23 ((TOP)) Download Flowjo Cracked Version Of 23 flowjo x 32 winamp What is Tree Star FlowJo What is FlowJo You can also check below here: ctrl + f Tree Star FlowJo X R2 Linux Tree bilin.com.mx also offer physical upgrade and replacement which includes a shipping fee. If your dongle is in good working condition, we can upgrade it bilin.com.mx you are unsure of which version your dongle allows access to, call or email for license bilin.com.mxe to v10 with your existing dongle: Contact Sales Upgrade to a FlowJo Portal license: Contact Sales or click here for more info. Your serial number will transfer and automatically authenticate all versions of v9 and v Nicole Pope on flowjo cracked version of Serial Number: Download and install the latest version of FlowJo v The update bilin.com.mx X is a next generation data analysis and visualization platform for single cell analysis of cytometry data. FlowJo v Minor update to FlowJo v Your dongle will automatically authenticate all versions of v9 and v Free Trial FlowJo License Upgrade with FlowJo X. Upgrading from v9ĭongle: Download and install the latest version of FlowJo v Your serial number will transfer and automatically authenticate all versions of v The main Window design not only allows you to explore the essential. Your dongle will automatically authenticate all versions of v A FLOWJO serial number is required to activate the full version of Flowjo Crack. FlowJo Portal license: Updating to the latest version of FlowJo for FlowJo Portal license holders is easy! Simply download the latest version of FlowJo v10 above and sign in with your FlowJo Portal ID.ĭongle: Download and install the latest version of FlowJo v
#Flowjo cracked version
0 notes
Flowjo mac crack
Flowjo mac crack full version#
If you have a portal account, choose “Use you FlowJo Portal account”. Next, if you have a dongle (a physical thumb drive that has a license key on it) plugged into your computer, FlowJo will detect it automatically and allow you to click “Done” to authenticate. First, click on the checkbox to accept the license terms. When FlowJo is launched for the first time, the FlowJo license information window will open with the licensing agreement and license options.
We encourage you to update to the most recent version of FlowJo.
To obtain a trial day serial number so that you may try FlowJo with your data please fill out the form on our day trial serial number page. For more information on obtaining a FlowJo license, please see our license options page or submit a request for a quote. However, until a portal license, serial number or dongle is provided, FlowJo will only load specially enabled demonstration data files.
Flowjo mac crack full version#
You have downloaded the full version of FlowJo. For more information on installation please see our pages describing installation from the web. Once the zip file is extracted, double-click on the icon to launch FlowJo. zip file and double-click it to extract the program. Choose to place a shortcut on the desktop, and when the installer finishes, double-click on the FlowJo shortcut icon to launch the program. exe file and open it to install the program. You can select your platform (Mac or PC) at the top of the page. Getting Started and FlowJo Licensing Informationįirst, you need to install FlowJo by downloading the installer from our website. If you have already installed FlowJo, you may skip to the Initial Launch, License Information, and License sections of this document below.
#Flowjo mac crack
0 notes
Flowjo Crack + Serial Number () Torrent Free Download
Flowjo Crack + Serial Number () Torrent Free Download
Flowjo Crack is a swiss army knife analyzing software program for cytometry data. Moreover, Flowjo creates the latest files in the cytometry standard form, etc. FlowJo Endeavor for your data with an excellent source of your data with full support. Add more, with this you can get more chances to quicken phenotype and immunology research. Furthermore, it is a modern type of application that works best for the next level of research and then gives you a good result in the form of one cell at a time.
Furthermore, the FlowJo Torrent is user-friendly and consists of the main workspace and many different ribbons that contain tabbed bands that permit you to scroll through various bands to access different tasks, etc. Moreover, this amazing software gives you the means to customize each band with the preferred tasks that you usually use. However, by using this tool you can also drag and drop samples or bands on the workspace.
Flowjo With Crack + Torrent [Mac] Download…
Moreover, the FlowJo Crack also can Measurement scales are typically logarithmic with Inordinate precision, etc. however, this method contains many programs within the have a look at health problems, especially most cancers. All in all, the Flowjo mac crack download has the ability to analyze the data on a laptop routinely makes it best for researchers to draw three-dimensional diagrams, etc. add more, the app may be used for each study and clinical purpose and presents good tools and competencies in each field.
All in all, the FlowJo Torrent Free Download trailblaze the new discoveries, indeed through curiosity, style of statistics representation, and much more. And, also the mobile kind is an important aspect for you in which you could check plugins for that. By using this tool you can create new projects daily. Likewise, it is collaborating on the effects you want and then depends upon the platform. However, you don’t need to worry about the lab data construction. Add more, FlowJo has a new trend to create smart projects. you can also download Flowjo mac crack from our site. However, If you think Flowjo serial number generator is more PayPal then don’t worry about it. Here we are providing it totally free. So, visit my site and enjoy Flowjo download cracked.
Key Features:
Furthermore, it is ideal for every kind of user.
It is very fast even you have an original version.
Add more you can also work in free to run your MAC.
Further, it is a perfect memory management system.
More, the frank is its own basic nature to beginners.
It has the ability to makes a new project for biological smart trends.
Also, has new instruments for agnostic problems and platforms.
Add more, one can create files in the cytometer standard format with its help.
Furthermore, scales up you to larger inputs for better improvements.
Moreover, a comprehensive tool works perfectly over Windows & Mac.
More, there are too many FCS files which it accepts for long-time accessibility.
Further, it’s a smart program for trailblazing analysis in or outside the lab.
Add more, Get your new ideas as you want with its help to grow up your research level.
Furthermore, the software is useful only in an advanced environment for the drag-drop feature.
Moreover, a single solution for flow analysis with a compatible view from one file to another, etc.
Likewise, it’s the Best modeling software for data analysis
What’s NEW:
Drag and drop analysis intuitively
Also, has advanced models for advanced data analysis
Furthermore, Publication-quality graphics
All in all, the Plug-in architecture with unique updates
System Requirements:
An Intel Core i7 dual or quad process is best 2. Required (16GB) of RAM over Windows 7,8 & 10 3. There should be a (MB) of space for it only
How To Crack?
Firstly, Click on to Download button which is given upper as well as below.
After that, click it and download it to your system
Then, Install into your System
So, run the software on your device.
Check it properly.
All is the installation process is done.
Enjoy Flowjo Crack.
#flowjo 10 crack flowjo 10 serial number crack flowjo crack flowjo crack mac flowjo crack flowjo crack windows flowjo cracked versi
0 notes
Flowjo Crack + Serial Number () Torrent Free Download
Flowjo Crack + Serial Number () Torrent Free Download
Flowjo Crack is a swiss army knife analyzing software program for cytometry data. Moreover, Flowjo creates the latest files in the cytometry standard form, etc. FlowJo Endeavor for your data with an excellent source of your data with full support. Add more, with this you can get more chances to quicken phenotype and immunology research. Furthermore, it is a modern type of application that works best for the next level of research and then gives you a good result in the form of one cell at a time.
Furthermore, the FlowJo Torrent is user-friendly and consists of the main workspace and many different ribbons that contain tabbed bands that permit you to scroll through various bands to access different tasks, etc. Moreover, this amazing software gives you the means to customize each band with the preferred tasks that you usually use. However, by using this tool you can also drag and drop samples or bands on the workspace.
Flowjo With Crack + Torrent [Mac] Download…
Moreover, the FlowJo Crack also can Measurement scales are typically logarithmic with Inordinate precision, etc. however, this method contains many programs within the have a look at health problems, especially most cancers. All in all, the Flowjo mac crack download has the ability to analyze the data on a laptop routinely makes it best for researchers to draw three-dimensional diagrams, etc. add more, the app may be used for each study and clinical purpose and presents good tools and competencies in each field.
All in all, the FlowJo Torrent Free Download trailblaze the new discoveries, indeed through curiosity, style of statistics representation, and much more. And, also the mobile kind is an important aspect for you in which you could check plugins for that. By using this tool you can create new projects daily. Likewise, it is collaborating on the effects you want and then depends upon the platform. However, you don’t need to worry about the lab data construction. Add more, FlowJo has a new trend to create smart projects. you can also download Flowjo mac crack from our site. However, If you think Flowjo serial number generator is more PayPal then don’t worry about it. Here we are providing it totally free. So, visit my site and enjoy Flowjo download cracked.
Key Features:
Furthermore, it is ideal for every kind of user.
It is very fast even you have an original version.
Add more you can also work in free to run your MAC.
Further, it is a perfect memory management system.
More, the frank is its own basic nature to beginners.
It has the ability to makes a new project for biological smart trends.
Also, has new instruments for agnostic problems and platforms.
Add more, one can create files in the cytometer standard format with its help.
Furthermore, scales up you to larger inputs for better improvements.
Moreover, a comprehensive tool works perfectly over Windows & Mac.
More, there are too many FCS files which it accepts for long-time accessibility.
Further, it’s a smart program for trailblazing analysis in or outside the lab.
Add more, Get your new ideas as you want with its help to grow up your research level.
Furthermore, the software is useful only in an advanced environment for the drag-drop feature.
Moreover, a single solution for flow analysis with a compatible view from one file to another, etc.
Likewise, it’s the Best modeling software for data analysis
What’s NEW:
Drag and drop analysis intuitively
Also, has advanced models for advanced data analysis
Furthermore, Publication-quality graphics
All in all, the Plug-in architecture with unique updates
System Requirements:
An Intel Core i7 dual or quad process is best 2. Required (16GB) of RAM over Windows 7,8 & 10 3. There should be a (MB) of space for it only
How To Crack?
Firstly, Click on to Download button which is given upper as well as below.
After that, click it and download it to your system
Then, Install into your System
So, run the software on your device.
Check it properly.
All is the installation process is done.
Enjoy Flowjo Crack.
#flowjo 10 crack flowjo 10 serial number crack flowjo crack flowjo crack mac flowjo crack flowjo crack windows flowjo cracked versi
0 notes
Flowjo envoy
FLOWJO ENVOY HOW TO
FLOWJO ENVOY SERIAL NUMBER
FLOWJO ENVOY INSTALL
Optimizing the use of FJ with these headphones will help you organize your data, improve analytics, and make it easier to understand and explain your data to others. This includes entering and using keywords, creating a push directory for FlowJo keys, distribution spreadsheets, FlowJo and R, and tables in FlowJo License.
FLOWJO ENVOY HOW TO
It’s fast to execute, but ends up with very long names in the output file.įlowJo FCS files are a powerful tool for performing and monitoring flow cytometry to test if you know how to use it properly.
FLOWJO ENVOY SERIAL NUMBER
Flowjo Serial Number This can be as simple as getting people to the editor. Finally, after analyzing the sample, we need to extract valuable data from the target population (% of the population, average fluorescence intensity, etc.). Take the time to add new plugins to your FJX and see how these tools can help manage the instability and productivity of your data. Flowjo freeload This is an advanced method for creating flow stabilization ports where there is an obvious problem with the data that can be generated, but FlowAI exposes many other problem areas.įlowjo Free One important reason is that this data can control the sensitivity of the analysis and increase the range of stakeholders. My favorite is Flowjo and this tool detects anomalies which then clears the data and creates a good and bad intersection. At the top right is a list of members, including the tension each parliament runs.įlowgo axis scale Finally, lower right is a graph of each representative in Parliament over time This will help determine if there are any issues that are significant when researching but are related later. This can be very useful for subsequent organization and data analysis. Flowjo alternative This way you can be sure that your keywords will last. In fact, it is highly recommended to add keywords when creating a file for inclusion in the tool. freeload Flowjo Mac Crack + Serial Number Here you will also see your selected keywords. On the left is a list of all the keywords in the file, from which gadget the recipients captured, etc. This allows you to use tools like SPACE, tSNE, Flow Som, e and more. Flowjo should also refer to the plug-in library software.
FLOWJO ENVOY INSTALL
To take advantage of these plugins, install the R program (for free), and don’t forget to direct FlowJo to the location indicated in the window of your choice. These packages often add some interesting and analytical features to the data.įlowJo License has created what they call a FlowJo portal and a way to transfer R content to FlowJo. Software productivity test packages from Flowjo version have proliferated as R over the past decade. A great infographic and conversion table for each step of editing the post you want to do. Flowjo Use it to process hundreds of forms, create entire tables, and delete slides. It allows you to create powerful batch features simply by dragging and dropping images. FlowJo provides an easy interface for the most demanding multivariate analysis systems. It performs a comprehensive analysis of thousands of models with millions of high-resolution accident cases. FlowJo Crack + Torrent For (Mac + Windows) freeloadįlowjo Crack is a scientific diagnostic software designed for streaming cellular data.
#Flowjo envoy
0 notes
Flowjo serial number mac generato
#FLOWJO SERIAL NUMBER MAC GENERATO CRACKED#
#FLOWJO SERIAL NUMBER MAC GENERATO SERIAL NUMBER#
#FLOWJO SERIAL NUMBER MAC GENERATO FULL CRACK#
#FLOWJO SERIAL NUMBER MAC GENERATO SOFTWARE#
Because of these circumstances, the test will guide you to the next stage of research. Therefore, being close to various notable instruments and features can help you to smooth the edges of your ideas to enhance the work cycle. Additionally, the cell type is a significant aspect which is why you should examine modules to help you with the information. It will analyze the revelations principally through the top way of displaying data. To summarize this, it is important to note that the FlowJo Crack is by and offering you an internet-based platform for the organization of turning to devour. It also provides the structure of a component that it is possible to do what you’d like to.
#FLOWJO SERIAL NUMBER MAC GENERATO SERIAL NUMBER#
Since FlowJo Serial Number provides another example to help you take advantage of, you can make a sharp start. There is no reason to worry about the development of lab data. It also cooperates with the results you desire and then depends on the setting. This way it’s notable in arranging the data to be used to make it easier for you to go on adventures. In order to move data in new methods, you can look at more information after eliminating the cell appraisal information and consequently the amazing idea of enunciation for data sets, etc. It is able to explore basic data used to conduct research. The current installer for this program will provide you with a lot of information to stream the cytometry. Performing a flow cytometry analysis is vital to diagnose health problems, especially blood cancers, but it can be helpful with other specialized applications for research and practice that is clinical. you can take your analysis towards the level that is next brand new features including spectral settlement, platform overlays, is now launching you an online source for the creation of turn burning.
#FLOWJO SERIAL NUMBER MAC GENERATO SOFTWARE#
This is a higher-level variety of software that works best for the next level of research and then provides you the end result that is best in the form of one cell at any given time.įlowJo Crack is an application that is powerful offers you a built-in environment for displaying and analyzing flow cytometric data. Right here, you are able to get more chances to accelerate immunology and phenotype research. FlowJo Serial Number strives for a highly skilled source to the data of your data with complete support. It makes brand new files within the cytometry form that is standard. The script editor allows access that is low-level FlowJo You may also organize projects that are numerous with this tool.įlowJo Torrent is a software that is analyzing cytometry data. This really is the world’s analyzing tool that is best. However, it is possible to also develop projects that vary daily basis. This really is additionally a tool that is universal evaluating. It is also a tool that is outstanding in examining.
#FLOWJO SERIAL NUMBER MAC GENERATO CRACKED#
You can get any cracked software With Lastest Keys from our website.įlowJo Crack is also most readily useful with page rulers with page breaks. Further, it also provides you with a program that is user-friendly. It also enables you to generate illustrations for publications or presentations. More, you can even run this device on Windows, Mac, and Linux. It additionally enhanced your amount of analysis. This device is commonly used by researchers and technicians.
#FLOWJO SERIAL NUMBER MAC GENERATO FULL CRACK#
DOWNLOAD FULL CRACK FlowJo Crack With Serial Number freeload įlowJo Crack provides you with an environment that is integrated viewing and analyzing flow cytometry information.
#Flowjo serial number mac generato
0 notes
Flowjo serial number free
#FLOWJO SERIAL NUMBER FREE SERIAL KEY#
#FLOWJO SERIAL NUMBER FREE FULL VERSION#
Speed up routine phenotyping available as you know it. FlowJo Crack Torrent + License key freeloadįlowJo Crack catalyzes and analyzes without any restrictions. You can also download this tool from our secure link. The download process for this tool is also simple. There are also billions of users of this tool. It also provides you with drag and drop functionality. The user of this tool is available all over the world. This program can be used for both research and clinical purposes. In the latest version, programs have been developed for the decomposition and display of information about streams. It is also the best platform for analysis. The entire analysis process is also carried out in a very short period of time. In addition, the speed of this tool is amazing. The design of the main window not only allows you to explore the basic functions of FlowJo. There are many other great features of this tool. This is everyone’s basic need for analysis. The Group section allows you to organize the samples in the order in which you want to analyze them. In addition, you can drag samples or bands to the workspace.
#FLOWJO SERIAL NUMBER FREE FULL VERSION#
FlowJo Crack Keygen Full Version freeloadįlowJo Crack allows you to customize each group with your favorite tasks that you usually use. Because FlowJo features a tendency to create wise projects. It is currently working on the ramifications that you then are contingent on the platform and desire. It is a favorite for coordinating the data to get projects. After that excellent caliber of saying you’ve got to get data sets, etc. For your delivery of fresh ways, you also can observe more stuff later expressing the penetration of cell review. That is a sophisticated form of application that is most suitable for the degree of study after which provides you the lead to the shape of a single cell at one time.įlowjo Crack can lead you a lot to flow cytometry. Here, you’ll get more opportunities to quicken immunology and phenotype research. FlowJo tries your computer data using a superb supply of one’s data with support. It makes files from the form that is cytometry.
#FLOWJO SERIAL NUMBER FREE SERIAL KEY#
Click To Download Flowjo Crack Serial Key Full Latest Version freeload įlowjo Crack is assessing applications for cytometry data.
#Flowjo serial number free
0 notes
Flowjo serial number free
FLOWJO SERIAL NUMBER FREE CRACKED
FLOWJO SERIAL NUMBER FREE MOVIE
Currently Age Of Empires 2 HD freeload PC game is the newest expansion pack for the game released after quite a long time.
Age Of Empires 2 HD freeload is basically the second flagship expansion pack for a marvelous strategy game (Age Of Empires 2 The Age Of Kings).
FLOWJO SERIAL NUMBER FREE CRACKED
- freeload PC Games Cracked full and complete game & repack from Mega, Uptobox, 1fichier, Turbobit, Uploaded, Zippyshare, bilin.com.mxise, simply click the 'FlowJo Portal Sign In' button at the top and enter your personal Portal account credentials. If you start with a serial number and your lab expands with more computers you can convert. If your computer has been used previously using the prior HWA system, you will need to remove that serial license number located in the middle right of that tab. It is a good option for labs and users who don’t want to worry about losing a dongle (or getting it stolen) or who only have one workstation they will be using for analysis. are the two new lush and splendid tweaks of Age Of Empires 2 HD freeload. A license number will run FlowJo on one, and only one, computer. Treaty and Capture The Relic Lecrae albums freeload. One of the best attributes of this game are the new included Civilizations such as the Indians, Italians, Slavs, and Incas and Magyars. When FlowJo is launched for the first time, the FlowJo license information window will open with the licensing agreement and license options. We encourage you to update to the most recent version of FlowJo. First Name: Last Name: Institution: Country: AFGHANISTAN ALBANIA ALGERIA AMERICAN SAMOA ANDORRA ANGOLA ANGUILLA ANTARCTICA ANTIGUA AND BARBUDA ARGENTINA ARMENIA ARUBA AUSTRALIA AUSTRIA AZERBAIJAN BAHAMAS BAHRAIN BANGLADESH BARBADOS BELARUS BELGIUM BELIZE BENIN. This expansproton of Age Of Empires II is also known as Age Of Empires II The Forgotten freeload. To obtain a trial day serial number so that you may try FlowJo with your data please fill out the form on our day trial serial number page. Please fill in the fields to receive a 30 day FlowJo serial number. Currently Age Of Empires 2 HD freeload PC game is the newest expansproton pack for the game released after quite a long time.
FLOWJO SERIAL NUMBER FREE MOVIE
It might be a funny scene, movie quote, animation, meme or a mashup of multiple sources. Age Of Empires 2 HD free download is basically the second flagship expansproton pack for a marvelous strategy game (Age Of Empires 2 The Age Of Kings). You can take any video, trim the best part, combine with other videos, add soundtrack.
#Flowjo serial number free
0 notes
Copytrans activation code generator download
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD FOR MAC#
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD CRACKED#
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD SERIAL KEY#
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD FULL VERSION#
There’ll be programs convey and to share with you the application form.
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD SERIAL KEY#
The application form to store and move connections cloudly can manage by you and the driver deal with the MAC and install at no cost.ĬopyTrans Serial Key variant keeps anyone away from file conversion, improves the i-OS experience, and can help you a whole good deal more time upgrading and program snapping. That is videos, transfers, and music all for all of your devices. That is just a data unit that performs simultaneous purposes such as sharing, data manipulation, and conversion around MAC, IOS, along with Android and handles all.ĬopyTrans Crack is Con-Tact managing perfect tool over Iphones, Ipods, and Ipad pills prepared to copy the utilized plug-in that is data-HEIC using a simple solution up on Windows. The computer software will be here now prepared to allow everybody else.
Connect your iPod, iPhone, or iPad to PC without iTunesĬopyTrans Crack Activation Code Torrent Latest Download For MacĬopyTrans Crack is a control center having to begin a system within mutually that is dual-platform.
What’s New In CopyTrans Crack Latest Version?.
CopyTrans Crack Main Features:.
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD FULL VERSION#
CopyTrans Crack Full Version Torrent Download For Win/Mac:.
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD FOR MAC#
CopyTrans Crack Activation Code Torrent Latest Download For bilin.com.mx restore the original MAC address of the network adapter, select the adapter, click Restore Original button in the Change MAC Address bilin.com.mx may even click Random MAC Address button to fill up a randomly selected MAC address from the vendor list available. Enter new MAC address in the field and click Change Now! button. In the Information tab, find the Change MAC Address bilin.com.mx will get the details of your selection below. Select the adapter you want to change the MAC bilin.com.mxng MAC address changer will list all available network bilin.com.mx can be found in the Advance settings tab in the Network Adapter's Device properties in Windows Device Manager. Some Network Adapter drivers have this facility built-in. If a value is present, windows will use it as MAC address, if not, windows will use the hard coded manufacturer provided MAC address. When the Network Adapter Device is enabled, windows searches for the registry value 'NetworkAddress' in the key HKEY_LOCAL_MACHINESYSTEMCurrentControlSetControlClass. This software just writes a value into the windows registry. You will then receive a license code which you can put into the software. 2 min - Uploaded by Keygen Free HereFlowJo Crack Full Serial Number + Torrent Mac+Win. Flowjo 10 Serial Number Crack 10 Serial Number Crack.
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD CRACKED#
6 PC x32/圆4 and MAC cracked full download. FlowJo lies within Development Tools, more precisely Database Tools. FlowJo can be downloaded from our website for free. Adobe Illustrator Mac Crack freeload The enterprise-general vector pics software program lets you create emblems, icons, drawings, typography, and illustrations for print, internet, video, and mobile. Apple, in its line of amazing Mac OX titles, launched the Mac OS Yosemite which took the world by storm. Mac OS X Yosemite is another product in Apple’s line of Mac OS X. Note: Let Us Know In the comments if any link is not working, We will update ASAP.
#Copytrans activation code generator download
0 notes
Flowjo Crack
is an evaluation device for applications that gather cytometry data. It produces records in the configuration that is cytometry. Flowjo Serial Key program tests your PC’s information overwhelmingly of information, with help. This is where you’ll track down more prominent chances to accelerate the method involved with phenotyping and immunology. It permits you to test the consequences of your exploration. To introduce your discoveries in better approaches to introduce your discoveries, you may likewise take a gander at more data later to show the effect of the survey of cells.
There is no prerequisite Since FlowJo Serial number tends to configuration savvy projects. A mind-boggling type of utilization’s suitable for the degree of exploration and provides you with the type of a solitary cell simultaneously. FlowJo Mac Crack is programming for investigating to break down cytometry information. It creates new records involving the standard arrangement for cytometry. FlowJo takes a stab at your information by giving an outstanding wellspring of your information that is completely upheld.
Following that awesome way of saying you really want to gather informational collections, etc. The group is exploring the ramifications that will rely on the application and your longing. Flowjo Full Cracked can assist you with learning numerous headings for stream Cytometry. Near different marvelous gadgets comparably to the different current features will become the smooth out of your tips to redesign the work example of it.
0 notes
FlowJo Crack + Keygen Download % Working FlowJo Crack is a commercial application that has an integrated environment for viewing and analyzing flow cytometry data. The weather display functions as a workspace, with
#FlowJo FlowJoCrack FlowJoSerialKey FlowJoFreeDownload FlowJoDownload FlowJoSoftware FlowJoMac FlowJoLicenseKey FlowJoFullVersion FlowJoT
0 notes
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: ImageQuant TL is the most automatic and easy-to-use general image analysis software available. It provides
• Automation for fast and consistent results.
• Optional ImageQuant SecurITy modules, designed to support and control traceability of data.
• Support of multicolor files.
• Editing tools to crop, rotate, and filter images.
• Advanced algorithms for delivery of accurate results.
Make:GE Healthcare
Form/Manual: Image QuantTL Gel Analysis/Quantitation Form
Administrator: Sonja Young
Administrator Contact: ()
Application: Agilent's GeneSpring GX software provides powerful, accessible statistical tools for fast visualization and analysis of microarrays - expression arrays, miRNA, exon arrays and genomics copy number data. Designed specifically for the needs of biologists, GeneSpring GX offers an interactive desktop computing environment that promotes investigation and enables understanding of microarray data within a biological context.
Make:Agilent Technologies
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: FlowJo is a software package that is capable of analyzing flow cytometry data. All files produced by assorted flow cytometers are written in the Flow Cytometry Standard format with an .fcs file extension. FlowJo will import and analyze cytometry data regardless of which FACS (Fluorescence Activated Cell Sorting) insrument/software is used to collect the data.
To use the Software please contact "Sandy" Ying-Sin Hsieh, who will explain how to download the software to your computer. The software access privileges are sometimes donglebased, and therefore will require you to sign-out for a dongle from PSC or come to some other arrangements with Flow-Jo.
Make:FlowJo
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: DeCyder 2-D Differential Analysis Software is specifically designed for 2-D fluorescence difference gel electrophoresis (DIGE) analysis and is a key element in the Ettan DIGE system (which we have). It is fullyully optimized and integrated to the 2-D DIGE platform.
Make:GE Healthcare Life Sciences
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: ImageMaster 2D software offers a flexible interface for the comprehensive visualization, exploration, and analysis of 2-D gel data from both 2-D DIGE (2-D fluorescence difference gel electrophoresis) and non-DIGE technologies. It is provided as altrenative to the use of Decyder 2D amalysis Software
Make:GE Healthcare Life Sciences
Form/Manual:ImageMaster 2D Proteomics Analysis Manual
Administrator:"Sandy" Ying Sin Hsieh or Sonja Young
Administrator Contact:
Application: The importance of sterilization is essential to good laboratory practice, particularly in biotechnology, pharmaceutical and clinical laboratories. Of all sterilization methods, high pressure steam (autoclave) is the most widely used because of its efficacy, speed and reliability. The department has a number of autoclaves, some run by steam and others use steam, but the steam is generated by water loaded into the autoclave and electricity.
Autoclaves are used in a wide variety of applications including:
• culture media preparation
• labware sterilization
• waste sterilization
Make:Steris/AMSCO
Administrator:Sonja Young
Administrator Contact:
Application: The importance of sterilization is essential to good laboratory practice, particularly in biotechnology, pharmaceutical and clinical laboratories. Of all sterilization methods, high pressure steam (autoclave) is the most widely used because of its efficacy, speed and reliability. The department has a number of autoclaves, some run by steam and others use steam, but the steam is generated by water loaded into the autoclave and electricity. Autoclaves are used in a wide variety of applications including:
• culture media preparation
• labware sterilization
• waste sterilization
Make: Sanyo, Hirayama, and New Brunswick
Administrator:Hyuk-Kyu Seoh
Administrator Contact:
Application: Thermo Electron offers the FRENCH Press and two models of FRENCH Pressure Cells for the disintegration of chloroplast materials, blood cells, unicellular organisms, homogenates of animal tissue and other biological particles. The pressure cell disrupts the cellular walls of a sample while leaving the cell nucleus undisturbed. This technique results in more uniform and complete disruption. The FRENCH Pressure Cell delivers higher pressures than bombs or decompression systems, without pre-treating the sample. Cells are lysed by forcing the cell or tissue suspension through a narrow space, thereby shearing the cell membraneøs.A French press consists of a piston that is used to apply high pressure to a sample volume of 40 to ml, forcing it through a tiny hole in the press. It can reach pressures of 20,, pounds per square inch (psi).
Make: Thermo Electron
Form/Manual:French Press Operation Manual
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: The Sonifier® ultrasonic cell disruptors are versatile laboratory tools designed to apply high-frequency ultrasonic energy to biological and chemical processing to provide:
• Cell disruption
• Nano particles
• Emulsifications
• Homogenization
• Cell lysis
• Processing DNA & proteins
• Fine mixing
• Degassing
Make: Fisher / Emerson Industrial Automation
Form/Manual:Sonicator Tip Operations Manual
Administrator:Hyuk_Kyu Seoh
Administrator Contact: ()
Application: The Sonifier® ultrasonic cell disruptors are versatile laboratory tools designed to apply high-frequency ultrasonic energy to biological and chemical processing to provide:
• Cell disruption
• The bath adapter allows for the simultaneous sonication. didruption of cells surrounded by ice water, to • unify cell disruption
Make: Fisher / Emerson Industrial Automation
Form/Manual:Sonicator (Bath) Operations Manual
Administrator:George Pierce
Administrator Contact:
Application: This system allows for continuous temperature control constantly maintaining cell suspensions at a low temperature. It offers a controlled cell breakage rate, and direct steam sterilization and flushing with antiseptics (DynoMill brochure).
Make: DynoMill
Form/Manual:KDL Agitator Bead Mill Service Form
Administrator:Sonja Young
Administrator Contact:
Application: The particle’s settling velocity in centrifugation is a function of the particle’s size and shape, centrifugal acceleration, the volume fraction of solids present, the density difference between the particle and the liquid, and the viscosity. The Avanti J has a fast accel/decel rate and can process large volumes of solutions. The rate of separation depends on the rotor radius and type.
Make: Beckman
Form/Manual:Avanti J Floor Operation Manual
Administrator:Sonja Young
Administrator Contact:
Application: The particle’s settling velocity in centrifugation is a function of the particle’s size and shape, centrifugal acceleration, the volume fraction of solids present, the density difference between the particle and the liquid, and the viscosity. The Avanti J XP has a fast accel/decel rate and can process large volumes of solutions. The rate of separation depends on the rotor radius and type.
Make: Beckman
Form/Manual:Avanti J XP Floor Operation Manual
Administrator:Sonja Young
Administrator Contact:
Application: The particle’s settling velocity in centrifugation is a function of the particle’s size and shape, centrifugal acceleration, the volume fraction of solids present, the density difference between the particle and the liquid, and the viscosity. The Avanti J has a fast accel/decel rate and can process large volumes of solutions. The rate of separation depends on the rotor radius and type.
Make: Beckman
Form/Manual:Avanti J Floor Operation Manual
Administrator:Sonja Young
Administrator Contact:
Application: The particle’s settling velocity in centrifugation is a function of the particle’s size and shape, centrifugal acceleration, the volume fraction of solids present, the density difference between the particle and the liquid, and the viscosity. The Avanti JI has a fast accel/decel rate and can process large volumes of solutions. The rate of separation depends on the rotor radius and type.
Make: Beckman
Form/Manual:Avanti JI XP Floor Operation Manual
Administrator:Sonja Young
Administrator Contact:
Application: The Sorvall RC5B can process large volumes of solutions. The rate of separation depends on the rotor radius and type.
Make: Sorvall
Form/Manual:Operation Manual
Administrator:Sonja Young
Administrator Contact: ()
Application: Centrifuge R is a high speed, refigerated centrifuge for medium capacity needs. It allows for molecular applications in tubes up to mL and offers additional swing-bucket and fixed-angle rotors as well as deepwell plate capacity for increased versatility.
Make: Eppendorf
Form/Manual: Refrigerated Tabletop Operation Manual
Administrator:Sonja Young
Administrator Contact: ()
Application: Centrifuge and R are -high speed centrifuges for medium capacity needs. They allow for molecular applications in tubes up to mL and offer additional swing-bucket and fixed-angle rotors as well as deepwell plate capacity for increased versatility.
Make: Eppendorf
Form/Manual: R Tabletop Operation Manual
Administrator:Sonja Young
Administrator Contact: ()
Application: The Centrifuge R combines the proven features of the Eppendorf microcentrifuges and the multipurposecentrifuges. They offer multiple application opportunities due to a high selection of different rotor types. Despite their compact size of approx. 35 cm width, special rotors for micro plates, 15 mL and 50 mL conical tubes can be easily used. Their incomparable versatility makes the Centrifuge and Centrifuge R the flagships under the Eppendorf microcentrifuges.
Make: Eppendorf
Form/Manual: R Tabletop Operation Manual
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: ÄKTA™Purifier and Explorer chromotography systems are designed for fast development and optimization of any biomolecular purification, using one working platform for all techniques and samples.
Applications: The method wizard and optimized system configurations, allows rapid media screening, method scouting, method optimization, and scaleup experiments. Standard system configurations are available to suit most purification needs, but are easily modified if required.
• Protein, peptide, nucleic acid purification in micro and gram scales
• Programmable sequential application of different columns up to 8
• Automated sample load up to 8 different samples or sequential load of samples
• Automated fraction collection in bulk or small fractions
• BufferPrep calculates and prepares the correct pH buffers
• Samples can be applied at flow rates up to 50 ml/min. and fractions can be collected without spillage at flow rates up to ml/min.
Make:GE Healthcare
Form/Manual:
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: ÄKTA™Pure chromotography systems are designed for the rapid development and optimization of biomolecular purification, using one working platform for all techniques and samples.
Applications: The method wizard and optimized system configurations, allows rapid media screening, method scouting, method optimization, and scaleup experiments. Standard system configurations are available to suit most purification needs, but are easily modified if required.
• Protein, peptide, nucleic acid purification in micro and gram scales
• Programmable sequential application of different columns up to 8
• Automated sample load up to 8 different samples or sequential load of samples
• Automated fraction collection in bulk or small fractions
• BufferPrep calculates and prepares the correct pH buffers
• Samples can be applied at flow rates up to 50 ml/min. and fractions can be collected without spillage at flow rates up to ml/min.
Further Information:GE Healthcare
Make:GE Healthcare
Form/Manual:
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application:ÄKTA™ Purifier and Explorer chromotography systems are designed for fast development and optimization of any biomolecular purification, using one working platform for all techniques and samples.
Applications: The method wizard and optimized system configurations, allows rapid media screening, method scouting, method optimization, and scaleup experiments. Standard system configurations are available to suit most purification needs, but are easily modified if required.
• Protein, peptide, nucleic acid purification in micro and gram scales
• Programmable sequential application of different columns up to 8
• Automated sample load up to 8 different samples or sequential load of samples
• Automated fraction collection in bulk or small fractions
• BufferPrep calculates and prepares the correct pH buffers
• Samples can be applied at flow rates up to 50 ml/min. and fractions can be collected without spillage at flow rates up to ml/min.
Make:GE Healthcare
Form/Manual:
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: ÄKTA start is an easy-to-use chromatography system that automates the rapid, manual purification procedures using small volume chromatography columns, for example HiTrap columns.
Further Information:GE Healthcare
Make:GE Healthcare
Form/Manual:
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application:ÄKTA™Purifier and Explorer chromotography systems are designed for fast development and optimization of any biomolecular purification, using one working platform for all techniques and samples.
Applications: The method wizard and optimized system configurations, allows rapid media screening, method scouting, method optimization, and scaleup experiments. Standard system configurations are available to suit most purification needs, but are easily modified if required.
• Protein, peptide, nucleic acid purification in micro and gram scales
• Programmable sequential application of different columns up to 8
• Automated sample load up to 8 different samples or sequential load of samples
• Automated fraction collection in bulk or small fractions
• BufferPrep calculates and prepares the correct pH buffers
• Samples can be applied at flow rates up to 50 ml/min. and fractions can be collected without spillage at flow rates up to ml/min.
Make:GE Healthcare
Form/Manual:
Administrator:Hyuk Kyu Seoh
Administrator Contact: ()
Application: The MDQ is a capillary-based analytical system separates sample components within a fused-silica capillary, using one of several modes of electrophoresis.
Applications: Examples of the different modes of electrophoresis include:
• Capillary Zone Electrophoresis
• Micellar Electrokinetic Capillary Chromatography
• Capillary Gel Electrophoresis
• Capillary Isoelectric Focusing
• Capillary Electrochromatography.
The system includes a P/ACE MDQ configured with both a photo diode array and selectable-wavelength UV/Vis (, , and nm filters included) detector, UV source optics, temperature-controlled sample storage module and 32 Karat™ Software. Typical applications are:
• Genetic analysis
• Chiral analysis
• Fast RNA purity analysis
• Basic drugs analysis
• Ion analysis
• Protein and Peptide analysis
Make: Beckman
Form/Manual: MDQ Service Form
Administrator: Hyuk Kyu Seoh
Administrator Contact:
Application: The Beckman HPLC has solvent delivery modules that are built with a rapid fill pump design that produce smooth flow from microbore to semi-preparative flow rates and thee high-pressure mixing design eliminates the need for constant helium sparging or degassing. The pumps are combined with high-sensitivity UV/VIS and diode array detectors and autosamplers. Flow range: - ml/min.; wavelength range: - nm; Maximum back pressure: 17 ul capacity flow cell; Programmable functions: wavelength, range, rise time, auto zero, event mark, relays, lamp off, peak detection, peak threshold, bandwidth and stop data.
Preparative HPLC refers to the process of isolation and purification of compounds. Important is the degree of solute purity and the throughput, which is the amount of compound produced per unit time. This differs from analytical HPLC, where the focus is to obtain information about the sample compound. Chemical Separations can be accomplished using HPLC by utilizing the fact that certain compounds have different migration rates given a particular column and mobile phase. Each compound should have a characteristic peak under certain chromatographic conditions. Depending on what needs to be separated and how closely related the samples are, the chromatographer may choose the conditions, such as the proper mobile phase, to allow adequate separation in order to collect or extract the desired compound as it elutes from the stationary phase. With these characteristic peaks, identification of compounds can be done. HPLC also allows for quantification of compounds by determining the unknown concentration of a compound in a known solution.
Make: Beckman
Form/Manual: HPLC Service Form
Administrator:Sonja Young
Administrator Contact: ()
Application: The Concentrator plus from Eppendorf is available in two configurations:
Complete system with an integrated service-free diaphragm pump
Basic concentrator for connecting to an existing vacuum.
The Concentrator’s heating technology optimizes the evaporation process. No matter which configuration you choose, you’re assured of quick and efficient—yet gentle—vacuum concentration of your samples (e.g. DNA/RNA, proteins).
The complete system includes a vapour condenser that purifies the exhaust air by up to 85%. This serves as protection against unpleasant vapours.
Make:Eppendorf
Form/Manual: Speed Vac Concentrator Operation Manual
Administrator:Sonja Young
Administrator Contact:
Application: The Vacufuge Concentrator is a complete system with solvent-resistant PTFE vacuum pump and vapor trap. Narrow, inch width saves valuable bench space. Motorless drive and sealed chamber provide trouble-free operation Evaporation Modes:
• Choice of three (aqueous, alcohol, off) to correspond with sample solvent and reduce processing time up to 20%.
• Maximize evaporation efficiency and prolong pump lifespan by periodically aerating the vacuum line, preventing condensation build-up.
Automatic vacuum release prevents sample loss from bumping and foaming. Brake feature brings rotor to a faster stop—allows quick access to samples. Choice of four heating levels (30°C, 45°C, 60°C, and ambient) allows safe and efficient concentration of a variety of samples. Besides the microfuge tube rotor, there is a micro plate rotor available upon request (see Debby).
Make:Eppendorf
Form/Manual: Vacufuge Operation Manual
Administrator:Ping Jiang
Administrator Contact: ()
Application:The capillary xl DNA Analyzer is the Gold Standard for high throughput genetic analysis. Use this for DNA fragment analysis applications such as microsatellites, AFLP, SNP analysis, mutation detection and traditional DNA sequencing. Get the highest quality data at a low cost per sample.
• Higher optical sensitivity and advanced polymers enable you to obtain higher-quality sequencing data for less.
• Multiple automation features decrease costly human errors.
• Optimized polymers increase your productivity without compromising your results.
• Perform a wide variety of sequencing and fragment analysis applications including resequencing, microsatellite analysis, AFLP, LOH, SSCP, SNP screening and SNP validation.
Make:Life Technologies
For Use and Further Information: DNA Sequencing Services
Administrator:Ping Jiang / Sonja Young
Administrator Contact: ()
Application: The Ion OneTouch™ 2 System simplifies the workflows for the Ion Proton™ and Ion PGM™ systems by providing an automated solution for scalable and reproducible template preparation. The Ion OneTouch™ 2 System: • Integrates multiple manual template preparation workflows into a single system
• Enables parallel processing of multiple samples per day through modular design
• Supports scalable template preparation for all Ion semiconductor sequencing chips
• Supports up to bases on the Ion PGM™ System and up to bases on the Ion Proton™ System*
• Includes a full thermal cycling modality for amplification for quick optimization of thermal cycling parameters
• Employs a peristaltic pump fluidic system that eliminates the need for gas
• Fits easily on any benchtop with its small instrument footprint
Make: Life Technologies (Thermofisher)
For Use and Further Information: DNA Sequencing Services
Administrator:Ping Jiang / Sonja Young
Administrator Contact: ()
Application: The IonS5 System combines semiconductor sequencing technology with natural biochemistry to directly translate chemical information into digital data, democratizing sequencing and making it accessible to virtually any lab or clinic. The Ion GeneStudio S5 Series is flexibly designed to enable a broad range of targeted NGS RNA/DNA sequence applications with industry-leading speed and scalability. Select from five different sequencing chips to sequence a throughput range from 2M to M reads per run. Simply choose the chip size and the instrument that matches your throughput and application needs.
Make: Life Technologies (Thermofisher)
For Use and Further Information: DNA Sequencing Services
Administrator:Ping Jiang / Sonja Young
Administrator Contact: ()
Application: The Ion Chef™ System is the next generation of workflow simplification products for the Ion Proton™ and Ion PGM™ systems. The Ion Chef™ System provides automated, high-throughput template preparation and reproducible chip loading for users at any experience level. With typically less than 15 minutes of hands-on time, an intuitive touch-screen interface, and significantly higher productivity than the Ion OneTouch™ 2 System, the Ion Chef™ System makes the Ion Torrent™ sequencing workflow accessible for every lab.
Make: Life Technologies (Thermofisher)
For Use and Further Information: DNA Sequencing Services
Administrator:Ping Jiang / Sonja Young
Administrator Contact: ()
Application: The Ion Proton™ System offers a complete workflow from sample through analysis, and variant calling or RNA analysis. It is used with the Ion Chef™ System* to enable automated, high-throughput template preparation and reproducible chip loading for users of any experience level. Built for speed, the Ion Proton™ System provides sequencing run times from 2–4 hours on the Ion PI™ Chip, taking you from DNA to variants in a single day. It is equipped with Ion Reporter™ Software, providing integrated tools for tertiary data analysis for DNA variation analysis across single, paired, or trio research samples.
Make: Life Technologies (Thermofisher)
For Use and Further Information: DNA Sequencing Services
Administrator:Sonja Young
Administrator Contact: ()
Application: The nCounter SPRINT platform is capable of degitally analyzing multiple pathways in a single tube in an extraction-free workflow requiring only 10 minutes of hands-on time -significantly benefiting your RNA, DNA, and protein profiling applications.
Make: Nanostring Technologies
For Use and Further Information:
For Basic Use Capabilities:Online Information
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact:
Application: This system lets you enhance resolution by entering two blocks of running conditions to be executed successively. The CHEF-DR II system is optimized for the most popular range of separations with a fixed angle of °. This unit can be used for separations of fragments up to 6 Mb in size by adjusting the running conditions for low voltage and extended run times. Besides mapping, this system can be used for:
• Strain typing-molecular epidemiology
• Apoptosis assays
• DNA damage and repair studies
• Large protein separations
Pulsed Field Gel Electrophoresis Is Still the Benchmark for Mapping Applications such as: • Disease locus mapping
• YAC, BAC, PAC, and cosmid mapping
• Chromosome rearrangements
• RFLP and DNA fingerprinting
Make: BioRad
Form/Manual:CHEF DR II Pulse Wave
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: Simple Western by ProteinSimple effectivley reinvents the entire Western blot process without gels, transfer tanks, blots or film - finally giving researchers a complete, walk-away solution for protein detection and characterization. All hands-on steps from sample loading and detection to quantitative data analysis are completely automated, eliminating the manual factors that can negatively impact reproducibility, quantitation, time to result and data reliability. Simon analyzes 12 samples per run in hours! Funding provided by Tech fee.
Make: Protein Simple
Form/Manual: Protein Simple Simon Western
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application:T he Gene Pulser Xcell™ system is a modular electroporation system for transfecting every cell type. The system includes a main unit, a ShockPod™ cuvette chamber, and your choice of accessory modules: the capacitance extender (CE module) and the pulse controller (PC module).
Features and Benefits:
• Universal electroporation — transfects all cell types, from primary and stem cells to bacteria and yeast
• Preset protocols — include the most common mammalian and bacterial cell types
• Flexibility — choice of programs for preset protocols, optimization protocols, manual operation, and/or user protocols
• Protocol library — collection of electroporation protocols for every cell type including primary, • immortal, and bacterial cells
• Data management — enables storage and recall of parameters used in the previous experiments, useful for troubleshooting
• Reproducibility — uses PulseTrac™ circuitry and arc-protection features to ensure reproducibility and sample protection
Make: BioRad
Form/Manual: Gene Pulser Xcell
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: The MicroPulser electroporator is a simple yet versatile instrument that enables safe and reproducible transformation of bacteria, yeast, and other microorganisms. Transformation efficiencies much higher than those obtained with chemical methods can be achieved.
Key Features:
• One-button pulse delivery, attached cuvette chamber, and rapid charge time for fast sample handling
• Preset, optimized programs for commonly studied bacteria and fungi allow rapid program selection
• Arc quenching (ARQ) system significantly reduces arcing, protecting against loss of valuable samples
• Broad range of parameters for manual optimization. Manual programming allows voltage to be selected • in a –3, V range with 10 V precision and allows pulse width to be selected in a – ms range with ms precision
• High-voltage 3, V capability yields improved efficiency in larger-volume cuvettes
• Compact, space-saving design
• Audible and visible pulse indicators
• Time constant and actual volts displayed to monitor reproducibility
Make: BioRad
Form/Manual: Micropulser Operation Manual
Administrator:Sonja Young
Administrator Contact: ()
Application: The X-OMAT A processes exposed radiographic film. The exposed film sheet is placed into an automatic film processor. The film is processed via rollers through tanks containing developer and fixer solutions, and finally through a wash system. The developed film emerges from the processor ready for reading by the researcher.
Make: Kodak
Form/Manual: X-Omat A Operation Manual
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: The BD Accuri™ C6 is a personal flow cytometer that is easy to use, simple to maintain, and affordable. The analytical power and versatility of today’s laser-based flow cytometry systems have unlocked the mysteries of cell biology and empowered entirely new fields of research. As a result, flow cytometry has become a staple of modern laboratories around the world.
Make:BD Biosciences
Form/Manual: Accuri C-6 Blue/Red
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: This benchtop system delivers high-speed sorting and multicolor analysis. The BD FACSAria instrument is the first benchtop sorter that incorporates a fixed-alignment cuvette flow cell, which minimizes startup time and improves reproducibility. This new flow cell provides superior fluorescence sensitivity and freedom from instrument maintenance and alignment. Gel coupling to the objective lens improves collection efficiency and increases sensitivity and resolution needed ofr multicolor sorting applications. Additional "Sort setup" and "sort monitoring" features in the system software makes the BD FACSAria instrument easy to use. BD FACS™ Accudrop technology is integrated into the system for quick and accurate drop-delay determination. Stream monitoring of the breakoff point and clog detection are incorporated. The system has four air-cooled lasers at nm, nm, nm and nm wavelengths. Two- and four-way bulk sorting devices for a variety of tube sizes are also available. Water Jacketed tube holders are also available to keep cells warm or cold as needed.
Applications are far reaching and can be found on the BD online tutorial.
Make:BD Biosciences
For Use and Further Information: Flow Cytometry and Cell Sorting Services
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: Built on more than 25 years of BD experience and leadership in flow cytometry and multicolor analysis, the BD FACSCanto™ II system is an easy-to-use benchtop analyzer that delivers proven performance, accuracy, and high-quality results.
The BD FACSCanto II provides the ultimate in flexibility and can be configured with two or three lasers to detect up to eight colors.*
Applications are far reaching and can be found on the BD online tutorial.
Make:BD Biosciences
For Use and Further Information: Flow Cytometry and Cell Sorting Services
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: The Auto utilizes bright field imaging and dual-fluorescence imaging to quickly and accurately identify and count individual cells. Cell count, concentration, diameter, and % viability are automatically calculated and reported.
Make:Nexcelom
Form/Manual: Cellometer Cell Counter
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: The BD LSRFortessa™ cell analyzer offers the ultimate in choice for flow cytometry, providing power, performance, and consistency. Designed to be affordable and expandable, the BD LSRFortessa has the flexibility to support the expanding needs of multicolor flow cytometry assays.
The Fortessa is configurable and upgradeable with up to 4 lasers to detect up to 18 colors simultaneously, BD LSR analyzers feature innovative designs for both the excitation optics and collection optics that reduce excitation losses and improve light collection efficiency. Our instrument has blue ( nm), red ( nm),yellow-green ( nm) and violet (nm) lasers. The addition of the yellow-green laser allows use of the new fruit fluorescent proteins such as mCherry. It also limits spectral overlap between FITC and PE – 2 of the most common fluorescent markers used in flow cytometry.
Applications are far reaching and can be found on the BD online tutorial.
Make:BD Biosciences
For Use and Further Information: Flow Cytometry and Cell Sorting Services
Administrator: Sonja Young and "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: Maintain viable stocks and strains at °C
Make: Thermo
Form/Manual: Freezer Manual
Administrator:Sonja Young and Hyuk Kyu Seoh
Administrator Contact: and
Application: Sublimation occurs when a frozen sample goes directly to the gaseous phase without passing through the liquid phase. As the ice sublimates, it leaves voids in the dry residual material making it easy to rehydrate. Freeze drying samples stabilizes them for storage, preservation, or shipping . Many times, drying causes damage and some loss of cellular or protein activity. Lyophilization is a method of sample preservation that significantly reduces damage to biological samples. Substances that are not damaged by freezing can usually be lyophilized so that refrigerated storage is unnecessary. Important exceptions are mammalian cells, nearly all of which are destroyed by lyophilization. However, many microorganisms and proteins survive lyophilization well, and it is a preferred method of drying vaccines, pharmaceuticals, blood fractions, and other laboratory samples. Some specialist food products are also lyophilized.
Make: Virtis
Form/Manual: BT EL Lyophilizer Tabletop Service Form
Administrator:Sonja Young and Hyuk Kyu Seoh
Administrator Contact: ()
Application: Sublimation occurs when a frozen sample goes directly to the gaseous phase without passing through the liquid phase. As the ice sublimates, it leaves voids in the dry residual material making it easy to rehydrate. Freeze drying samples stabilizes them for storage, preservation, or shipping . Many times, drying causes damage and some loss of cellular or protein activity. Lyophilization is a method of sample preservation that significantly reduces damage to biological samples. Substances that are not damaged by freezing can usually be lyophilized so that refrigerated storage is unnecessary. Important exceptions are mammalian cells, nearly all of which are destroyed by lyophilization. However, many microorganisms and proteins survive lyophilization well, and it is a preferred method of drying vaccines, pharmaceuticals, blood fractions, and other laboratory samples. Some specialist food products are also lyophilized.
Make: LabConco
Form/Manual: Freezone Large Service Form
Administrator:Sonja Young and Hyuk Kyu Seoh
Administrator Contact: ()
Application: Sublimation occurs when a frozen sample goes directly to the gaseous phase without passing through the liquid phase. As the ice sublimates, it leaves voids in the dry residual material making it easy to rehydrate. Freeze drying samples stabilizes them for storage, preservation, or shipping . Many times, drying causes damage and some loss of cellular or protein activity. Lyophilization is a method of sample preservation that significantly reduces damage to biological samples. Substances that are not damaged by freezing can usually be lyophilized so that refrigerated storage is unnecessary. Important exceptions are mammalian cells, nearly all of which are destroyed by lyophilization. However, many microorganisms and proteins survive lyophilization well, and it is a preferred method of drying vaccines, pharmaceuticals, blood fractions, and other laboratory samples. Some specialist food products are also lyophilized.
Make: LabConco
Form/Manual: Freezone Large Service Form
Administrator:Sonja Young
Administrator Contact: ()
Application: Leveraging technologies adapted from the semiconductor industry, Affymetrix, the principle manufacture of GeneChip arrays uses photolithography and solid-phase chemistry to produce arrays containing hundreds of thousands of oligonucleotide probes packed at extremely high densities. The probes are designed to maximize sensitivity, specificity, and reproducibility, allowing consistent discrimination between specific and background signals, and between closely related target sequences.
Attesting to their powerful capabilities, GeneChip arrays are applied in a wide variety of DNA and mRNA analyses. Recent analytical accomplishments include the elucidation of interactions between signaling pathways involved in development, the discovery of a new class of leukemia, and the development of new assays to track drug metabolism.
Make: LabConco
Form/Manual: Freeze Dry System 4 Small Service Form
Administrator:Sonja Young and Hyuk Kyu Seoh
Administrator Contact: ()
Application: Leveraging technologies adapted from the semiconductor industry, Affymetrix, the principle manufacture of GeneChip arrays uses photolithography and solid-phase chemistry to produce arrays containing hundreds of thousands of oligonucleotide probes packed at extremely high densities. The probes are designed to maximize sensitivity, specificity, and reproducibility, allowing consistent discrimination between specific and background signals, and between closely related target sequences.
Attesting to their powerful capabilities, GeneChip arrays are applied in a wide variety of DNA and mRNA analyses. Recent analytical accomplishments include the elucidation of interactions between signaling pathways involved in development, the discovery of a new class of leukemia, and the development of new assays to track drug metabolism.
Make: LabConco
Form/Manual: Lyophilizer Small Service Form
Administrator: Sonja Young
Administrator Contact: ()
Application: Leveraging technologies adapted from the semiconductor industry, Affymetrix, the principle manufacture of GeneChip arrays uses photolithography and solid-phase chemistry to produce arrays containing hundreds of thousands of oligonucleotide probes packed at extremely high densities. The probes are designed to maximize sensitivity, specificity, and reproducibility, allowing consistent discrimination between specific and background signals, and between closely related target sequences.
Attesting to their powerful capabilities, GeneChip arrays are applied in a wide variety of DNA and mRNA analyses. Recent analytical accomplishments include the elucidation of interactions between signaling pathways involved in development, the discovery of a new class of leukemia, and the development of new assays to track drug metabolism.
Make: LabConco
Form/Manual: Lyophilizer Small with Dry Ice Tap Service Form
Administrator: Sonja Young
Administrator Contact: ()
Application: Model Gel Dryer allows the drying of acrylamide and other gel types.
The Model gel dryer has a 35 x 45 cm drying surface, which is large enough to fit up to 16 mini gels, 9 Criterion gels, 2 large format gels, or 1 sequencing gel.
Make: BioRad
Form/Manual:
Administrator:Sonja Young
Administrator Contact: ()
Application: Leveraging technologies adapted from the semiconductor industry, Affymetrix, the principle manufacture of GeneChip arrays uses photolithography and solid-phase chemistry to produce arrays containing hundreds of thousands of oligonucleotide probes packed at extremely high densities. The probes are designed to maximize sensitivity, specificity, and reproducibility, allowing consistent discrimination between specific and background signals, and between closely related target sequences.
Attesting to their powerful capabilities, GeneChip arrays are applied in a wide variety of DNA and mRNA analyses. Recent analytical accomplishments include the elucidation of interactions between signaling pathways involved in development, the discovery of a new class of leukemia, and the development of new assays to track drug metabolism.
Make: Affymetrix
For Use and Further Information: Genomics Microarray Services
Administrator:Sonja Young
Administrator Contact: ()
Application: The GeneChip® Fluidics Station is used for the wash and stain operation of Affymetrix GeneChip® arrays. The instrument includes design advancements to provide improved ease of use and true walk-away freedom dramatically improving efficiency in your genetic analysis.
Make: Affymetrix
For Use and Further Information: Genomics Microarray Services
Administrator:Sonja Young
Administrator Contact: ()
Application: GeneChip® Hybridization Oven provides uniform hybridization environmment for consistent RNA : chip bound DNA interactions, allowing for appropriate discrimination between specific and background signals, and between closely related target sequences.
Make: Affymetrix
For Use and Further Information: Genomics Microarray Services
Administrator: Chung Dar Lu and P.C. Tai
Administrator Contact: ()
Application: DNA Microarrays and Proteomic Technologies allow scientists to detect genes or proteins that are coregulated and whose patterns of change correlate with something important such as a disease state. However there is no assurance that these changes are really significant to the cell. Phenotype MicroArrays are a complementary technology providing the needed information at the cellular level and much more. After a genetic change or exposure to a drug lead, the researcher can directly evaluate the cellular response to that change. Phenotype MicroArrays can monitor, either directly or indirectly, most known aspects of cell function. The range of phenotypes includes:
• Cell surface structure and transport functions
• Catabolism of carbon, nitrogen, phosphorus, and sulfur
• Biosynthesis of small molecules
• Synthesis and function of macromolecules and cellular machinery
• Cellular respiratory functions
• Stress and repair functions
• Other cellular properties
Make: Biolog
Form/Manual: Biolog Phenotype Microarray
Administrator:Sonja Young
Administrator Contact: ()
Application: The popular GenePix® B Microarray Scanner has earned its outstanding reputation due to its incredible, intuitive, and reliable operation. Our commitment to engineering excellence guarantees that the GenePix B Microarray Scanner remains the benchmark in microarray scanning technology. In we updated the electronics to provide a state-of-the-art microarray scanner with the finest quality components while maintaining the features and performance that you have become accustomed to.
Make: Molecular Devices
Form/Manual: GenePix MicroArray Scanner
Administrator:Sonja Young
Administrator Contact: ()
Application: The Histocenter 3 embeds tissue samples into paraffin blocks for microtome sectioning.
Make: Shandon
Form/Manual: Histocentre 3
Administrator:Sonja Young
Application: The HM Microtome esnures that sectioning of paraffin blocks into extremely thin slices proceeds at an optimal sectioning temperature
Make: Fisher
Form/Manual: HM Microtome
Administrator:Sonja Young
Application: This microtome sections paraffin blocks into extremely thin slices using a sliding motion
Make: bilin.com.mx
Form/Manual: Microtome Model 86C Sliding
Administrator:Sonja Young
Administrator Contact: ()
Application: This microtome sections paraffin blocks into extremely thin slices using a sliding motion
Make: Unknown
Form/Manual: Rotory Microtome Service Form
Administrator:Ping Jiang
Administrator Contact:
Application: The Bioanalyzer provides for a rapid visualisation of sample quality and quantity. High sensitivity with minimal sample quantities. Significant time savings - up to12 samples in 30 minutes. Reduced use and waste of hazardous chemicals.
Make: Agilent
Form/Manual: Bioanalyzer
Administrator:Ping Jiang
Administrator Contact:
Application: The Qubit™ Fluorometer is the next generation of the popular benchtop fluorometer that accurately measures DNA, RNA, and protein using the highly sensitive Qubit quantitation assays. The concentration of the target molecule in the sample is reported by a fluorescent dye that emits a signal only when bound to to the target, which minimizes the effects of contaminants—including degraded DNA or RNA—on the result. The easy-to-use touch screen menus make it easy to select and run the assays you need, with results displayed in just a few seconds Key features of the Qubit Fluorometer include: Powerful, dual-core processor quickly and accurately quantifies DNA, RNA, and protein, in less than 5 seconds per sample Uses as little as 1 μL of sample Stores up to 1, sample results Large inch state-of-the-art color touch screen for easy workflow navigation Ability to personalize your Qubit Fluorometer with the assays you run most, add new assays, or even create your own with MyQubit
Make:Thermofisher
Form/Manual: Qubit 3 Fluorometer
Administrator:Hyuk-Kyu Seoh
Administrator Contact:
Application: Exceptional sensitivity for quantitation of biomolecules labeled with chemiluminescent probes Supports gel documentation of Coomassie™ blue and silver-stained samples. Accurate quantitation of closely spaced bands in complex protein samples for gels and films up to 18 x 12 cm. Low noise for longer exposure times and lower background, important for precise quantitation of very weak signals. Wide linear dynamic range for precise quantitation of faint and dark bands over four orders of magnitude in the same image, avoiding time-consuming multiple film exposures. Distortion, dark frame, and flat frame corrections are applied to each imaging mode for optimal precision and uniform quantitation. Sensitive detection of less than 40 pg of protein on a Western blot. Sensitivity may be increased by "binning" of up to 8 x 8 pixels and smoothing. Chemiluminescent and colorimetric signals can be captured in the same image without changing the lens.
Make: GE Healthcare
Form/Manual: LAS mini Chemiluminescence
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact:
Application: Amersham Imager is a sensitive and robust chemiluminescence imager for high-resolution digital imaging of protein and DNA samples in gels and membranes. Intuitive operation: You can operate the instrument from a tablet computer with easy-to-use image analysis software. No prior imager experience or training is required to obtain high-quality results. Excellent performance: Advanced optics provides high-resolution images, high sensitivity, and broad dynamic range. Robustness: An optimal instrument for multi-user labs.
Make: GE Healthcare
Form: LAS mini Chemiluminescence Service Form
Administrator:Sonja Young
Administrator Contact:
Application: Some applications on the Omega 10g are SYBR Green stained gels and GFP expressed experiments and Qdot multi-plexed western blots. The instrument has megapixel resolution, touch pad control panel, adjustable height sample tray, variable intensity UV Transilluminator and multi-wavelength LED Epi-Illumination.
Make: Ultra Lum
Form/Manual:Omega 10g
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact:
Application: The Luminex MagPix System has been recently purchased (Summer'19). It belongs to a family of Flow cytometric systems enables you to multiplex (simultaneously measure) up to 50 analytes in a single microplate well, using very small samples. The MAGPIX system's imaging capapbility is based on a CCD technology that allows for it to be a more compact, robust system. It’s also easy to operate and maintain with streamlined start-up and shutdown protocols and minimal maintenance requirements, delivering fast and cost-effective bioassay results on many assay formats including nucleic acid assays, receptor-ligand assays, immunoassays, and enzymatic assays.
Make: Luminex
Form/Manual/website:MAGPIX System
Administrator: Sonja Young
Administrator Contact:
Application: Non-Fluorescent & Colorimetric Gels: Coomassie Blue, Silver stain, Autorad film, colony plates and Fluorescent Gels. This self-contained gel imaging system features a scientific grade megapixel CCD camera for capturing high resolution images with simple yet versatile capture and save options. Screen tilts to optimum viewing angle. A built-in computer touch screen supplies a complete system at one location for fluorescent and colorimetric imaging, while the attached comp.
NO ETHIDIUM BROMIDE is to be used in this instrument
Make: UVP
Form/Manual:UVP old EtBr OK Service Form
Administrator: Sonja Young
Administrator Contact:
Application: Non-Fluorescent & Colorimetric Gels: Coomassie Blue, Silver stain, Autorad film, colony plates and Fluorescent Gels. This self-contained gel imaging system features a scientific grade megapixel CCD camera for capturing high resolution images with simple yet versatile capture and save options. Screen tilts to optimum viewing angle. A built-in computer touch screen supplies a complete system at one location for fluorescent and colorimetric imaging.
Make: UVP
Form/Manual:UVP EtBr OK
Administrator: Sonja Young
Administrator Contact:
Application: Non-Fluorescent & Colorimetric Gels: Coomassie Blue, Silver stain, colony plates and Fluorescent Gels. InGenius3 is a self-contained, low budget gel documentation and analysis fluorescence applications. It features a compact darkroom which has a sliding front door and an internal LED white light. InGenius3 has a 3m pixel camera and can produce images with 16 bit image depth. A manual zoom lens and manual filter drawer (includes a UV filter) completes the package.
Make: Syngene
Form:UVP EtBr OK Service Form
Administrator: Hyuk-Kyu Seoh and "Sandy" Ying-Sin Hsieh
Administrator Contact: or
Application: The Typhoon is an older version fo the TyphoonTrio, and can image store phosphor autoradiography and many types of fluorescent stains (direct blue-excited fluorescence – and nm; direct green-excited fluorescence – nm; direct red-excited fluorescence – nm. This imager is specifically designed for 2-D DIGE multicolor scanning and detection of CyDye DIGE Fluor dye-labeled proteins. Other common fluorescent stains that this imagers can image are Deep Purple, Coomasie Blue, EtBr, SYPRO red and SYPRO Ruby. They can image agarose and acrylamide gels, blots, microarray slides and imaging plates of many different sizes.
Make: GE Healthcare
Form/Manual:Typhoon Phospho/ Fluorescent
Administrator: Sonja Young
Administrator Contact: ()
Application: Key RSDP Features of FluorChem Imaging System
• Resolution: Megapixel CCD resolution: Megapixels
• Proprietary algorithms for 3D image contour, image sharpening, and noise reduction for improved image resolution and quality.
• Sensitivity: Deep CCD peltier cooling facilitates multiple hour long exposures and exceptional image quality.
• FluorChem as an optimized for CCD imaging technology to generate femtogram sensitivity levels.
• Dynamic Range: > O.D. dynamic range with FluorChem Imaging System.
• Performance: Fast, easy, versatile, and powerful for comprehensive fluorescence and chemiluminescence applications AND basic gel documentation.
• Automatic lane/band detection and analysis with smiling corrections are easily done with a single button click!
• Capture grayscale or true color images with automatic RGB color image overlay feature.
Make: Bucher biotec
Form/Manual:Alpha Innotech Imaging Systems Manual
Administrator:Sonja Young
Administrator Contact: ()
Application: Culture and Cell Incubation
Make:Thermo-Fisher
Form/Manual:Incubator
Administrator: Sonja Young
Administrator Contact: ()
Application: The classic C25 incubator shakers are large capacity shakers utilizing an eccentric counter balanced drive to provide horizontal plane rotary motion in a 1" ( cm) circular orbit. Shaker speed and temperature are precisely regulated by a microprocessor controller that maintains setpoints within very rigid tolerances. Touch the keypad to select and display temperatures from a few degrees above ambient to 60º (Model C25), and 17º below ambient (minimum +4º) to 60º, (Model C25KC).
Make:New Brunswick
Form/Manual:Shaker, C25 Floor
Administrator: Sonja Young
Administrator Contact: ()
Application: The Series 25 incubator shakers are medium to large capacity shakers whose shaker speed and temperature are precisely regulated by a microprocessor controller that maintains setpoints within very rigid tolerances. Touch the keypad to select and display temperatures from a few degrees above ambient to 60º (Model Series 25), and 17º below ambient (minimum +4º) to 60º, (Model Series 25KC). NB. Even though this particular Shaker is well able to regulate it's temperature it NEEDS an additional thermometer to view temperature within the cabinet
Make:New Brunswick
Form/Manual:Shaker, Series 25 Floor
Administrator:Sonja Young
Administrator Contact: ()
Application: New Brunswick Floor Incubator Shakers E25R offers the largest capacity (flasks up to 6 L) in the Excella® line for shaking, incubating, and optional cooling. Choose from standard ambient models or refrigerated models that operate at 15°C below ambient to 60°C. The reliable microprocessor control system enables precise setting of speed, running time and temperature and automatically compensates for changes in load, voltage or temperature. - See more at: bilin.com.mx#bilin.com.mx
Make: New Brunswick
Form/Manual:Shaker, E25 Floor
Administrator: Sonja Young
Administrator Contact: ()
Application: The classic incubator shakers are large capacity shakers utilizing an eccentric counter balanced drive to provide horizontal plane rotary motion in a 1" ( cm) circular orbit. Shaker speed and temperature are precisely regulated by a microprocessor controller that maintains setpoints within very rigid tolerances. Touch the keypad to select and display temperatures from a few degrees above ambient to 60º (Model C25), and 17º below ambient (minimum +4º) to 60º, (Model C25KC).
Make:New Brunswick
Form/Manual:Shaker, Classic Floor
Administrator: Sonja Young and "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application:Thermo Scientific™ MaxQ shakers are versatile incubated/refrigerated units featuring a easy side access drain system making cleaning spills easy and retractable foot casters to easily position the shaker in the lab. MaxQ incubated and refrigerated floor shakers feature a foot pedal for hands-free operation and a large slanted viewing window to check the progress. These shakers are ideal for cell culture, solubility studies, plasmid purification, staining and destaining, extraction procedures, protein expression and many other applications
Make:Thermo Scientific
Form/Manual:Shaker, MaxQ Floor/Refrig Service Form
Administrator: Sonja Young
Administrator Contact: ()
Application: Large-capacity, environmental shakers for incubation and/or refrigeration.
• Wide temperature range
• Uniform temperature, regardless of sample location
• Rapid temperature equilibration
Make:New Brunswick
Form/Manual:Shaker, Innova Floor
Administrator: Sonja Young and "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: Features a heavy-duty drive and cool-running motor for long life and quiet operation under heavier loads and higher speeds.
Intuitive, spill-proof keypad allows easy input of parameters
in. (cm) LED display shows running conditions and diagnostics (all models except E1)
UniCentric™ drive and brushless DC motor ensure quiet, vibration-free operation
Versatile—use same accessories as other New Brunswick Scientific shakers
Two-year warranty on parts and labor (US and Canada only)
Make:New Brunswick
Form/Manual:Shaker C24 Tabletop
Administrator: Sonja Young and "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application:The E24 / E25 shakers combine incubated/refrigerated temperatures with orbital shaking in a compact footprint. They use minimal bench space and are affordably priced. These benchtop shakers are ideal for cell culture, solubility studies, extraction procedures, protein expression and many other applications
Make:New Brunswick
Form/Manual:Shaker E24 Tabletop
Administrator: Sonja Young and "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: Thermo Scientific™ MaxQ is a versatile, incubated and refrigerated shaker ideal for incubating a small number of vessels.
The MaxQ shakers combine incubated/refrigerated temperatures with orbital shaking in a compact footprint. They use minimal bench space and are affordably priced. These benchtop shakers are ideal for cell culture, solubility studies, extraction procedures, protein expression and many other applications
Make:Thermo Scientific
Form/Manual:Shaker MaxQ Tabletop
Administrator: Sonja Young
Administrator Contact: ()
Application: Thermo Scientific™ Mini is a versatile, incubated and refrigerated shaker ideal for incubating a small number of vessels. The Mini shakers combine incubated/refrigerated temperatures with orbital shaking in a compact footprint. They use minimal bench space and are affordably priced. These benchtop shakers are ideal for small cell culture, solubility studies, extraction procedures, protein expression and many other applications
Make:Thermo Scientific
Form/Manual:Mini Q Shaker Tabletop
Administrator: Sonja Young
Administrator Contact: ()
Application: Open air benchtop shakers are ideal for small cell culture, solubility studies, extraction procedures, protein expression and many other applications
Make:Thermo Scientific
Form/Manual:Rotating Shaker MaxQ
Administrator: Sonja Young
Administrator Contact: ()
Application: Sterilize glassware and other high temperatre needs
Make:Thermo-Fisher
Form/Manual:Oven Tabletop
Administrator: Sonja Young
Administrator Contact: ()
Application: Thermo-Fisher chamber furnaces are ideal for use in crowded laboratories and for common applications such as materials testing, burning, rapid heat processes.
Make:Thermo-Fisher
Form/Manual:
Administrator: "Sandy" Ying Sin Hsieh or John Houghton
Administrator Contact: () or ()
Application: The AFM is one of the foremost tools for imaging, measuring, and manipulating matter at the nanoscale. The information is gathered by "scanning" the surface on which the biological samples is based with a mechanical probe. Piezoelectric elements that facilitate tiny but accurate and precise movements on (electronic) command enable the very precise scanning. Electric potentials can also be scanned using conducting cantilevers. In this more advanced versions, currents can be passed through the tip to probe the electrical conductivity or transport of the underlying surface. There are various modes of scanning, which include:
•Contact Mode
•Non-Contact Mode
•Peak Force Mode (new to the VIII upgrade) which analyzes each tip-sample interaction to extract nanomechanical properties including modulus, adhesion, deformation, and dissipation.
Make: Bruker
For Use and Further Information:Atomic Force Microscope Services
Administrator: Bill Walthall
Administrator Contact: ()
Application: Deconvolution is a computationally intensive image processing technique that is being increasingly utilized for improving the contrast and resolution of digital images captured in the microscope. The foundations are based upon a suite of methods that are designed to remove or reverse the blurring present in microscope images induced by the limited aperture of the objective.
This upgrade using a new UNIX based OS, allows the user to image material in 4D at high resolution ( mm pixels). A CoolSnap HQ2 CCD camera allows the software to apply sophisticated algorithms to remove out of focus light and reassign refracted light to the calculated point of origin. The result is an image with a broad dynamic range of signal and stunning detail. The system is equipped with DIC optics, allowing the user to combine DIC and fluorescent light microscopy. The upgraded software is considerably more user friendly. 3D and 4D reconstructions are easier to setup and also has improved resolution. Possible applications include:
•High resolution imaging of cells and subcellular structure with multichannel detatil.
•Imaging of living cells over time.
•Detection and quantication of cell permeant, expressed, or injected fluorescent probes in living cells
•3D and 4D reconstructions
Make: DeltaVision
Form/Manual:Deltavision Website
Administrator: "Sandy" Ying Sin Hsieh or Liana Artinian
Administrator Contact: () or ()
Application: TILL Photonics Imaging system offers advanced equipment used for a variety of different applications studying dynamic processes in living cells such as:
•Measurement of rapidly changing intracellular ion concentrations (Ca2+, Na+ and other ions) e.g. in neurons.
•Study of signal transduction processes in response to e.g. growth factors or cytokines.
•Study of calcium sensitive processes.
•Simultaneous imaging of different target molecules within one sample using multiple staining with different dyes or probes.
•Metabolic transport.
•Cell-cell interactions.
Make:TILL Photonics
Form/Manual:TILL Photonics Imaging System Service Form
Administrator: Bill Walthall
Application: The Arturus Pixcell IIE laser capture microdissection system is specifcally designed around an olympus microscope for the isolation of specific cell types or tissue from tissues processed by paraffin embedding or cryo-sectioning. This microdisections permits the molecular analysis of pure populations of cells or specific regions of tissures. The system has a number of applications,
• Analysis of cell surface antigens and biomarkers
• Immunophenotyping of cells for stem cell and hematopoietic cell lineage studies
• Hematology
• Cell size and Cell Cycle studies
• Apoptosis, necrosis and live/dead cell assays
Make:Life Technologies (Arcturus)
Form/Manual:System Brochure
Administrator: John Houghton
Administrator Contact: ()
Application: Axio Imager 2 combines everything you've ever asked for in your research environment: brilliant optics and bright fluorescence. The contrast manager and light manager ensure defined conditions and reproducible results at all times. Use ACR to automatically detect and configure objectives and filter sets for Axio Imager.Z2
Make:Zeiss Axioimager 2
Form/Manual:Zeiss Axioimager 2
Administrator: John Houghton
Administrator Contact: ()
Application: The Axio Observer 2 inverted, automated fluorescent Microscope combines everything you've ever asked for in your research environment: brilliant optics and bright fluorescence. The contrast manager and light manager ensure defined conditions and reproducible results at all times. Use ACR to automatically detect and configure objectives and filter sets for Axio Observer.Z2
Make:Zeiss Axio Observer 2
Form/Manual:Zeiss Axioimager 2
Administrator: "Sandy" Ying Sin Hsieh and Hyuk Kyu Seoh
Administrator Contact:
Application: You can access pre-stored calculations such as ratios which provide double emission readout in a FRET-based or cell viability assay. You can run endpoint assays with one or two wavelengths or scan the entire wavelength range. You can also follow enzyme kinetics in real time.
Other applications: Enzyme kinetics - Temperature controlled reagent reservoirs with plate temperature control for stability and accuracy. Can be integrated with PerkinElmer automated liquid handling platforms; Cellular - Well area scanning. Can be integrated with PerkinElmer automated liquid handling platforms; Viable cell - Optional bottom reading offering signicant improvements for viable cell assays; ELISA - Photometric technology and AlphaLISA allow conversion to homogenous ELISA technology; GFP and other fluorescent proteins - Quad monochromators, bottom reading and well scanning; Luminescent Reporter gene and cell growth - Ultra-sensitive luminescence with dynamic range for low transfection rates; Calcium - dispenser for suspension cells convenient in receptor activation studies; Dual luciferase flash - enabled by dispenser option; Nucleis acid/protein quantitation - photometric technology.
Make: Perkin Elmer
Form/Manual:
Administrator: "Sandy" Ying-Sin Hsieh
Administrator Contact:
Application: VICTOR3 comes with several standard features such as temperature control, shaking, area scanning, adjustable measuring height, below fluorescence reading, dual label/ratio reading and kinetics. A dispenser is also available for cell-based assays by enabling fast kinetics measurements, enzyme assays and numerous other cellbased drug discovery assays.
Technologies and reading modes- Fluorescence Intensity (* nm)
• Fluorescence Polarization (* nm)
• Time-Resolved Fluorescence (TRF)
• Luminescence
• Glow, flash and dual luminescence
• Absorbance ( nm)
• UV Absorbance ( nm/ nm)
Make: PE
Form/Manual:Victor Plate Reader UV/Vis/Fluorescent
Administrator: Hyuk-Kyu Seoh
Administrator Contact:
Application:
•Powerful RDA features of GPS Explorer™ Software for flexible acquisition and data processing.
• Unmatched sensitivity (subfemtomole) in both MS and MS/SM modes
• Enhanced Precursor Ion Selection
• Profile biomolecules directly on tissue samples; sample (tissue section, whole organs or whole animals) can be analyzed directly, no extraction of compounds is required and no sample labeling required.
•ProteinPilot Software enables searching for over post-translational modifications, up to 45 work-up modifications and all amino acid substitutions, genetic variants and unexpected cleavages.
• Enhanced Mass accuracy. Using an internal standard, ppm mass accuracy is achieved, increasing confidence in protein ID.
• Quantitation of Specific proteins using iTRAQ reagents. iTRAQ reagents are multiplexed sets of 8 isobaric reagents which allows for sophisticated time course studies, absolute quantitation and monitors qualitative protein changes under different physiological conditions.
• Biomarker Discovery using iTRAQ reagents. Besides biomarker identification, iTRAQ allows quantitation that would indicate which proteins are changing in response to a given environmental change, drug treatment or disease.
• Post-source-decay for peptide sequencing. MALDI CID capability for protein sequence determination and structural analysis.
Make: ABI
For Use and Further Information:MALDI / Proteomic Services
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application:This technique sorts proteins according to two independent properties in 2 steps: the first-dimension step, isoelectric focusing (IEF), separates proteins according to their isoelectric points (pI); the second-dimension step, SDS-polyacrylamide gel electrophoresis (SDS-PAGE), separates proteins according to the molecular weights (MW). Each spot on the resulting two-dimensional array corresponds to a single protein species in the sample.
Make: GE Healthcare
Form/Manual:2D Gel Electrophoresis
Administrator: Hyuk-Kyu Seoh and "Sandy" Ying-Sin Hsieh
Administrator Contact: or
Application: The Typhoon Trio can image Storage phosphor autoradiography and many types of fluorescent stains (direct blue-excited fluorescence – and nm; direct green-excited fluorescence – nm; direct red-excited fluorescence – nm. This imager is specifically designed for 2-D DIGE multicolor scanning and detection of CyDye DIGE Fluor dye-labeled proteins. Other common fluorescent stains that this imagers can image are Deep Purple, Coomasie Blue, EtBr, SYPRO red and SYPRO Ruby. They can image agarose and acrylamide gels, blots, microarray slides and imaging plates of many different sizes.
Make: GE Healthcare
Form/Manual:Typhoon Trio Phospho, Fluorescent
Administrator: Hyuk-Kyu Seoh
Administrator Contact:
Application: Designed for use with most common 2-D gels. A protein pick-list is generated form 2D PAGE Gel, either automatically using predefined selection criteria, or manually. The protein pick-list is transferred to Ettan™ Spot Picker, which then automatically picks the protein spots according to the list. A wash step is performed after each picking session, and the location of each picked protein in its respective microplate well is automatically logged to facilitate sample tracking. When picking a limited number of protein spots, or for pooling of samples, the software also includes a “click-and-pick” function whereby proteins can be picked without a pick-list. The system accommodates any gel size up to - mm and picks from 1-mm as well as mm thick gels. respectively. Processing of 96 samples is performed in less than 30 min.
Make: GE Healthcare
Form/Manual:Spot Picker
Administrator: Hyuk-Kyu Seoh
Administrator Contact:
Application: Digester is a highly versatile instrument designed to perform in-gel digestion of proteins captured in 2-D gel electrophoresis spots. The instrument acts directly on Ettan™ Spot Picker output files, automatically tracking samples from spot picking to completed digestion using simple "plug-and-play" routines. It allows robust and reproducible digestion, sensitive to fmol range. Default digestion protocols are optimized and compatible with Coomassie™, silver, and fluorescence staining systems. A method editor also allows customization of methods. Standard microplates further increase ease-of-use, as do low-salt digestion buffers, eliminating the need for desalting (no need for C18 clean-up)
Make: GE Healthcare
Form/Manual:Digester Service Form
Administrator: "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: The Real-Time PCR Systems offer high performance, multicolor real-time PCR wherever your research takes you. Choose from our Fast and standard systems.
Real-time quantitative PCR has many applications including the precise measurement of changes in gene expression, pathogen detection, and post-PCR detection in allelic discrimination (SNPs) assays. It is also ideal for plus/minus assays to confirm the presence or absence of a pathogen, transgene, or other specific target sequence:
• well-format high-speed thermal cycling, delivering high quality results in less than 30 minutes
• Offers robust high resolution melting analysis
• Learn more about the Fast Real-Time PCR System
Make:Life Technologies
Form/Manual: Fast Operation Manual
Administrator: "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: StepOnePlus™ Real-Time PCR Systems offer intuitive software, Fast (<40 min) and standard (<2 hr) runs, and are configured for PC-free or networked operation. These factory-calibrated systems make it easy to step up to high-performance qPCR. And now these systems support high resolution melt (HRM) software
Make:Life Technologies
Form/Manual:StepOne Operation Manual
Administrator: "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: QuantStudio3™ Real-Time PCR Systems offer intuitive software, Fast (<40 min) and standard (<2 hr) runs, and are configured for PC-free or networked operation with intuitive software ineterface. These factory-calibrated systems make it easy to step up to high-performance qPCR using Applied Biosystems™ OptiFlex™ technology with white LED and 4 coupled channels enables optimal well-to-well and instrument-to-instrument accuracy.
Make:Life Technologies
Form/Manual:QuantStudio3 Operation Manual
Administrator: Ping Jiang
Administrator Contact:
Application: Biomek NX puts every aspect of liquid handling – including pipetting, dilution, dispensing, and integrations – into a single, automated system that is powerful and flexible. The NXP workstation offers multiple configurations, including multichannel, Biomek NX features Span-8 with gripper and can rotate a full °. The Span 8 is used for rapid plate-to-plate; tube to plate applications and assay miniaturization. Pipetting performance for low-volume reaction setup and assay miniaturization, as well as accurate and repeatable results extending into the submicroliter range. Applications
• DNA/RNA purification
• PCR setup and cleanup
• DNA Sequencing setup and cleanup
• Reproducible and high throughput for mutliple assays
Make: Beckman
Form/Manual:Biomek NX
Administrator: "Sandy" Ying-Sin Hsieh
Administrator Contact:
Application: The Biomek Laboratory Automated Workstation provides simple, intelligent automation of liquid-handling tasks. Pipetting, diluting and dispensing operations are performed quickly, easily and automatically. The modular platform allows expansion of system capability to include plate heating and cooling, plate washing, high-density transfers, photometric measurement.
These applications include:
Immunology: ELISA, EIA, RIA, Forensic Blood Typing.
Molecular Biology: DNA Sequencing, DNA Fingerprinting, PCR Processes, DNA Template Preparation, High-Density Library Maintenance and Screening, Sample Quantitation and Normalization, as well as Protein/enzymes Assays
Make: Life Technologies
Form/Manual:Biomek
Administrator: Sonja Young
Administrator Contact:
Application: The LS can count 3H, 14C, I, 35S and 32P. The instrument calculates counts per minute (cpm). Data can be normalized and blanks and/or backgrounds can be subtracted. You can set up a manual count or set up a User program with your specific needs (isotope and count time, for example). (LS Operator’s Manual).
Make: Beckman
Form/Manual:LS Scintillation Counter
Administrator:Sonja Young
Administrator Contact: ()
Application: 30 mm of solid lead provides effective shielding which gives constant background and minimal crosstalk. Multichannel analyer (MCA) technology incorporates a high resolution channel multichannel analyzer dedicated to each detector. It can count manually as well as automatically. With an energy range up to keV and a powerful set of software, Wizard gives you results from a wide range of applications including all RIA and IRMA tests, screening assays, etc. Ideal for chromium release studies - no crosstalk from samples on the conveyer means that the Wizard is ideal for working with higher energy isotopes such as Chromium; Vendor: Wallac
Make: Perkin Elmer
Form/Manual: Wizard Gamma
Administrator:Hyuk-Kyu-Seoh and "Sandy" Ying Sin Hsieh
Administrator Contact: ()
Application: The Frontier FTIR is powerful and adaptable range of Frontier™ IR systems and is assured to meet the needs of your current IR analysis. It can also be expanded to offer flexible system configurations in the near, near-mid, mid-far and far infrared regions, Frontier can support an extensive range of applications thanks to its superb sensitivity and configurability.
Chemical and Materials: From troubleshooting manufacturing problems, identifying product contaminants to gaining a deeper understanding of advanced material properties.
Research & Academia: Complete far-IR characterization of synthesized and novel materials, or quickly adapt the flexible platform for different research areas or groups
Make:Perkin Elmer
Form/Manual:Frontier_FTIR Brochure
Administrator:Ping Jiang and "Sandy" Ying Sin Hsieh
Administrator Contact: ()
Application: The Eppendorf Biophotometer® is a small, very compact spectrophotometer for measurements in the UV and VIS range. Spectra can be recorded and individual wavelength measurements can be made in a spectral range of nm to nm. What's more, the cuvette shaft of the Biophotometer kinetic is temperature controlled from +20°C to +42°C, meaning that enzyme and substrate kinetics can be measured directly in the device. No device upgrade with accessories is necessary for temperature bilin.com.mx Biophotometer fluorescence in addition to the Biophotometer basic has the option to determine very low concentrations of biomolecules using fluorescent dyes and can increase the measuring range by a factor of 1,, for detecting DNA for example.
Product characteristics:
• UV/Vis spectral range nm to nm
• Xenon flash lamp with very long service life
• Preprogrammed methods for a quick start
• Guided software process to minimize errors
Make:Eppendorf
Form/Manual:Biophotometer Operation Manual
Administrator:Ping Jiang and "Sandy" Ying Sin Hsieh
Administrator Contact: ()
Application: The BioPhotometer plus offers a compact UV/Vis photometer for use in molecular biology, biochemistry and cell biology and provides instant, out-of-the-box access to 32 routine methods, of which 9 methods are freely programmable,
e. g.:
• Measurement of DNA, RNA and protein concentration (UV and colorimetric)
• Incorporation rate of fluorescent molecules ( nm/ nm), e. g., for microarray experiments
• Enzymatic assays (e.g., peroxidase, alkaline phosphatase, β-galactosidase)
• Optical density of cells (OD )
Both measurement and calculation of results are performed at the press of a button, and the results of the analysis, as well as all accompanying data, are available at a glance. This guarantees safe, error-free operation and reliable results.
Make:Eppendorf
Form/Manual:Biophotometer Operation Manual
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: The Nanophotometer is an All-in-One spectrophotomer with micro volume ( ul) and optimized for quantification and purity assessment of nucleic acid and protein samples. Sample Compression Technology allows for accurate (+/- 5%) and reproducible ( Abs) readings of nucleic acids, proteins and peptides. This technology also is tolerant of a wide range of buffers that often interfere with an accurate reading. Funding provided by Tech fee.
Make: Implen
Form/Manual:Nanophotometer Operation Manual
Administrator:Ping Jiang and "Sandy" Ying Sin Hsieh
Administrator Contact: ()
Application: The NanoVue spectrophotometer is an easy-to-use and reliable instrument for the measurement of nucleic acid and protein samples. Samples of μl to 5 μl can be pipetted directly onto the gold-colored sample plate for measurement, and then simply recovered using a pipette. If sample recovery is not required, the sample plate can be quickly and easily wiped clean.
Make:GE Healthcare
Form/Manual:Nanovue Operation Manual
Administrator: "Sandy" Ying-Sin Hsieh and Sonja Young
Administrator Contact: ()
Application: The Mastercycler® family offers ultimate reliability combined with easy to use software. The universal block can work with all common consumables and increases the range of application flexibilities. The Mastercycler gradient has SteadySlope® technology ensuring optimal, constant heating and cooling rates, which means that results of gradient experiments can be transferred to routine applications.
Features:
• SteadySlope® and Triple Circuit Technology
• Gradient block1: up to 20°C gradient span is possible at any step of the PCR program
• Universal block2: Possible to use mL tubes, mL tubes or plates
• Simple programming for gradient function, adjustable ramp rates, time and temperature increments, incubation mode, link function, pause function
• Software-supported in situ Adapter
• RS and printer interface
• Auto-restart option in the event of a power failure
personal card system
Make: Eppendorf
Form/Manual:Mastercycler Gradient Service Form
Administrator:"Sandy" Ying-Sin Hsieh and Sonja Young
Administrator Contact: ()
Application: The Mastercycler® family offers ultimate reliability combined with easy to use software. The universal block can work with all common consumables and increases the range of application flexibilities. The Mastercycler gradient has SteadySlope® technology ensuring optimal, constant heating and cooling rates, which means that results of gradient experiments can be transferred to routine applications.
• Advantages of Mastercycler pro:
• Ultimate reduction of evaporation
• Extremely fast heating and cooling rates
• Gradient blocks with SteadySlope technology
• Intuitive graphic programming
• Display to indicate cycler number in a network
• Optional self-test of peltier elements
Make: Eppendorf
Form/Manual:Mastercycler Gradient Pro Service Form
Administrator: Sonja Young
Administrator Contact:
Application: Some of the separation Methods used in preparative ultracentrifugation:
Differential centrifugation: pelleting. Start with a uniform mixture of sample – molecules or organelles in buffer. Centrifuge to obtain pellet of heavier molecules, and supernatant.
Density gradient centrifugation: Rate zonal (also termed sedimentation velocity, zone centrifugation). Use a continuous density gradient of solvent such as sucrose. Density increases toward the bottom of tube. Sample is layered on top. Centrifuge until molecules form discrete bands depending upon their sedimentation values. Generally stop the run before any of the molecules reaches the bottom. % separation is possible with a small sample. Separates molecules based on size (MW). Used to separate various types of macromolecules – mixture of proteins; different types of RNA; separate DNA from RNA, or proteins; ribosomal subunits; polyribosomes.
Density gradient centrifugation: Isopycnic centrifugation (also termed sedimentation equilibrium centrifugation). Mix gradient material (such as cesium chloride- CsCl) with sample molecules. During the centrifugation, the CsCl generates a gradient (“self-generating gradient”), and the molecules move to the position in the gradient where their density is the same as the gradient material. Requires long centrifugation time to form a gradient ( hrs). Separates molecules based on their density – may have the same size. Often used to separate various types of DNA – circular vs linear, double stranded vs single stranded, DNA from RNA (RNA pellets), highly repetitive DNA (satellite DNA) from other DNA in the cell, can be used for separation of lipoproteins and cell organelles.
Make: Beckman
Form/Manual:Optima XLK Ultra Floor/a>
Administrator: Sonja Young
Administrator Contact: ()
Application: Differential centrifugation: pelleting. Start with a uniform mixture of sample – molecules or organelles in buffer. Centrifuge to obtain pellet of heavier molecules, and supernatant.
Density gradient centrifugation: Rate zonal (also termed sedimentation velocity, zone centrifugation). Use a continuous density gradient of solvent such as sucrose. Density increases toward the bottom of tube. Sample is layered on top. Centrifuge until molecules form discrete bands depending upon their sedimentation values. Generally stop the run before any of the molecules reaches the bottom. % separation is possible with a small sample. Separates molecules based on size (MW). Used to separate various types of macromolecules – mixture of proteins; different types of RNA; separate DNA from RNA, or proteins; ribosomal subunits; polyribosomes.
Density gradient centrifugation: Isopycnic centrifugation (also termed sedimentation equilibrium centrifugation). Mix gradient material (such as cesium chloride- CsCl) with sample molecules. During the centrifugation, the CsCl generates a gradient (“self-generating gradient”), and the molecules move to the position in the gradient where their density is the same as the gradient material. Requires long centrifugation time to form a gradient ( hrs). Separates molecules based on their density – may have the same size. Often used to separate various types of DNA – circular vs linear, double stranded vs single stranded, DNA from RNA (RNA pellets), highly repetitive DNA (satellite DNA) from other DNA in the cell, can be used for separation of lipoproteins and cell organelles.
Make: Beckman
Form/Manual:Optima MAX Ultra Tabletop
Administrator: Sonja Young
Administrator Contact: ()
Application: Differential centrifugation: pelleting. Start with a uniform mixture of sample – molecules or organelles in buffer. Centrifuge to obtain pellet of heavier molecules, and supernatant.
Density gradient centrifugation: Rate zonal (also termed sedimentation velocity, zone centrifugation). Use a continuous density gradient of solvent such as sucrose. Density increases toward the bottom of tube. Sample is layered on top. Centrifuge until molecules form discrete bands depending upon their sedimentation values. Generally stop the run before any of the molecules reaches the bottom. % separation is possible with a small sample. Separates molecules based on size (MW). Used to separate various types of macromolecules – mixture of proteins; different types of RNA; separate DNA from RNA, or proteins; ribosomal subunits; polyribosomes.
Density gradient centrifugation: Isopycnic centrifugation (also termed sedimentation equilibrium centrifugation). Mix gradient material (such as cesium chloride- CsCl) with sample molecules. During the centrifugation, the CsCl generates a gradient (“self-generating gradient”), and the molecules move to the position in the gradient where their density is the same as the gradient material. Requires long centrifugation time to form a gradient ( hrs). Separates molecules based on their density – may have the same size. Often used to separate various types of DNA – circular vs linear, double stranded vs single stranded, DNA from RNA (RNA pellets), highly repetitive DNA (satellite DNA) from other DNA in the cell, can be used for separation of lipoproteins and cell organelles.
Make: Beckman
Form/Manual:Optima MAX-XP Ultra Tabletop
Administrator: Sonja Young
Administrator Contact:()
Application: Some of the separation Methods used in preparative ultracentrifugation:
Differential centrifugation: pelleting. Start with a uniform mixture of sample – molecules or organelles in buffer. Centrifuge to obtain pellet of heavier molecules, and supernatant.
MGE are probably saying: "Oh what the hell it was worth a shot" regarding the DMCA claim, but it was not the core of their case. Copy DVD Audio to MP3, Copy DVD Audio to WMA, Solaris and Linux, can be used in LAN Hardware Dongle Security Repair facility in case your data is corrupted, you Unzip the FLEXID9_Windows_v7_50_x Dumping part is not implemented in USB Dongle Backup and Recovery yet, however we are working on this. Make sure the laptop battery is charged before you go to the airport; expect to be required to remove the laptop from its carrying case. A dongle is a security device, typically used to prevent people from using unauthorized copies of software The purpose of the dongle is copy protection or authentication of software to be used on a system Copy the folder "XPROG-BOX5 X7 0 is also a dongled Version The dongle crack is an attempt to get around this, often by attempting to use a Jun 05, · November 20, - pm xloem. ca and let us know what version of WinPCSIGN you own. It connects to a parallel port and acts a passthrough device for a parallel printer. What is HASP and dongle. Bernina and Janome dongles, as far as I know, are all technically a USB “HASP key”. Main specs: Over 39 features or apps protected with a single key. Just a note that this video appears to be no longer available on Youtube. Is it possible?Answer: It is not possible to physically clone a USB hardware key, but virtual cloning is done for the first time by Application software can be authorized and run with a virtual copy of the hardware key the same way it runs with a real dongle key. x3d, . Feb 06, · 1 Open a command prompt. EFT Dongle is very easy to use including a user friendly interface. Convert. These USB license dongles for copy protection offer anywhere from 15 to license options. The email address to which the data should be sent is the one in the first line of the copy. More new and enhanced features include: the enhanced embroidery wizard, ability to see thumbnail previews of your designs in Windows Explorer, new Enter the lock ID number in the text field, then press the button to generate the key. Thus, we can check the license number via license server record. Sep 17, · A USB security dongle (also referred to as a hardware key) is an electronic copy protection device that should be plugged into a USB port of a computer in order to unlock the functionality of a particular software application. fix created using Edius Editing Software. Filter Type: All. Meet the YubiKey. Execute USBTrace. Install this on the Windows target PC’s if you use WF dongles. img bs=4M You can show progress copy bar with status option for the dd command: Aft India Edius USB Dongle offers copy protection lock for Edius project and files by dongle. Some of the services we provide Dongle Brand. img bs=SIZE To clone a usb stick named /dev/sdb to ~/usb-opensuse-current. Find your dongle in the list, check the radio button next to its name and click "Share". In the Group or user names list, select the SYSTEM account. Click on the "Properties" button on the right side of the window to view more Sep 18, · How To Install EFT Dongle شرح تنصيب وتفعيل العملاق. dat files from CRK folder to installed folder. High Speed – ROCKEY4ND was designed to process even very complex algorithms with minimal delay for your application. g eth1) assign the network to firewall zone wan. (see screenshot below) This command will give you a list of all wireless network profiles on each interface on your PC. exe", Copy that to C:\Program Files\cosids\bin and overwrite the 2 files. Tap the “i” icon next to your network. I was told you can backup your copy as long as you do not turn on other upgrades you do not have. Even if it is a Wi-Fi dongle, you still need to plug it into your computer for the first time to activate it. Are you able to access the dongle through your operating system and see the folders inside it? 3. Right click on it and select "Update driver software". 4. Sign In to Infinity Online Service (IOS) Click to Download & Support. 0. Dongle Backup PRO interface. . Dec 06, · To clone SSD to USB flash drive: Step 1. WF-Dongle Device Driver. 5. DUSB
Flowjo cracked
FLOWJO CRACKED CRACKED
FLOWJO CRACKED SERIAL NUMBER
In addition, the user interface of the program is designed very simply and ribbons are used to group the tools, which gives quick access to the desired tool. In this program, you are able to define different samples in separate groups and analyze them in order. By right-clicking on different samples, you can change the group profile, including name, color, font, styles, roles, and so on. For each example separately, you can perform various operations such as adding keywords, statistics, displaying datasets, and so on. This program can be used for both research and clinical purposes and has provided useful tools and capabilities in every field. Therefore, analyzing this data in the computer automatically and by drawing three-dimensional diagrams has made the work of researchers very easy. Also, the cell sort is a big thing for you where you can check plugins for that. it will trailblaze the discoveries, simply by curiosity style of data representation. This technique has many applications in the study of health disorders, especially cancer. For this purpose, the FlowJo Crack is now introducing you as an online source for the creation of turn burning. Measuring scales are usually logarithmic with high accuracy. This program is able to display the collected data in the form of one-dimensional, two-dimensional, or three-dimensional histograms. FlowJo is one of the powerful software in the field of analysis and display of flow cytometric data. For your delivery in new ways, you can also observe more things. FlowJo Crack have a user friendly interface and exist on main workspace and many ribbons that contain tabbed bands which allow you to scroll through many bands to access different tasks. Flowjo Crack can guide you a lot for flow cytometry.
FLOWJO CRACKED SERIAL NUMBER
After the data was collected by this device, by entering it into the computer and analyzer software, we no longer have anything to do with the device and we can continue to work with the software. FlowJo Crack With Serial Number The FlowJo Crack is a powerful application that facilitate you an environment for displaying and analyzing flow of data. Flucymetry, or FCM, is a good way to count and analyze microscopic particles such as. Description: FlowJo is a powerful software for displaying and analyzing fluorescent data.
FLOWJO CRACKED CRACKED
This is done by a special device called a flow cytometer.Ī flow cytometer is able to derive the phenotype and characteristics of cells based on fluorescence emission. Download FlowJo x86 圆4 full license working forever Link download FlowJo win32 win64 full cracked forever. Flow cytometry or FCM is a suitable method for counting and analyzing microscopic particles such as chromosomes and cells. FlowJo is a powerful software for displaying and analyzing flow cytometric data.
#Flowjo cracked
0 notes
Flowjo cracked
#Flowjo cracked how to#
#Flowjo cracked for mac#
Paste number FlowJo vX download crack Pasted by: sxv sx When: 5 years, 11 months ago Share:
Flowjo cracked
FLOWJO CRACKED CRACKED
FLOWJO CRACKED SERIAL NUMBER
In addition, the user interface of the program is designed flowjo dongle replacement fee Free Activators simply and ribbons are used to group the tools, which gives quick access flowjo dongle replacement fee Free Activators the desired tool. In this program, you are able to define different samples in separate groups and analyze them in order. By right-clicking on different samples, you can change the group profile, including name, color, font, styles, roles, and so on. For each example separately, you can perform various operations such as adding keywords, statistics, displaying datasets, and so on, flowjo dongle replacement fee Free Activators. This program can be used for both research and clinical purposes and has provided useful tools and capabilities in every field. Therefore, analyzing this data in the computer automatically and by drawing three-dimensional diagrams has made the work of researchers very easy. Also, the cell sort is a big thing for you where you can check plugins for that. it will trailblaze the discoveries, simply by curiosity style of data representation. This technique has many applications in the study of health disorders, especially cancer. For this purpose, the Flowjo dongle replacement fee Free Activators Crack is now introducing you as an online source for the creation of turn burning. Measuring scales are usually logarithmic with high accuracy. This program is able to display the collected data in the form of one-dimensional, two-dimensional, or three-dimensional histograms. FlowJo is one of the powerful software in the field of analysis and display of flow cytometric data. For your delivery in new ways, you can also observe more things. FlowJo Crack have a user friendly interface and exist on main workspace and many ribbons that contain tabbed bands which allow you to scroll through many bands to access different tasks. Flowjo Crack can guide you a lot for flow cytometry.
FLOWJO CRACKED SERIAL NUMBER
After the data was collected by this device, by entering it into the flowjo dongle replacement fee Free Activators and analyzer software, we no longer have anything to do with the device and we can continue to work with the software. FlowJo Crack With Serial Number The FlowJo Crack is a powerful application that facilitate you an environment for is foobar good Crack Key For U and analyzing flow of data. Flucymetry, or FCM, is a good flowjo dongle replacement fee Free Activators to count and analyze microscopic particles such as. Description: FlowJo is a powerful software for displaying and analyzing fluorescent data.
FLOWJO CRACKED CRACKED
This is done by a special device called a flow cytometer.Ī flow cytometer is able to derive the phenotype and characteristics of cells based on fluorescence emission. Download FlowJo x86 圆4 full license working forever Link download FlowJo win32 win64 full cracked forever. Flow cytometry or FCM is a suitable method for counting and analyzing microscopic particles such as chromosomes and cells. FlowJo is a powerful software for displaying and analyzing flow cytometric data.
#Flowjo cracked
0 notes
Flowjo cracked
#Flowjo cracked how to#
#Flowjo cracked for mac#
Paste number FlowJo vX download crack Pasted by: sxv sx When: 5 years, 11 months ago Share:
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: ImageQuant TL is the most automatic and easy-to-use general image analysis software available. It provides
• Automation for fast and consistent results.
• Optional ImageQuant SecurITy modules, designed to support and control traceability of data.
• Support of multicolor files.
• Editing tools to crop, rotate, and filter images.
• Advanced algorithms for delivery of accurate results.
Make:GE Healthcare
Form/Manual: Image QuantTL Gel Analysis/Quantitation Form
Administrator: Sonja Young
Administrator Contact: ()
Application: Agilent's GeneSpring GX software provides powerful, accessible statistical tools for fast visualization and analysis of microarrays - expression arrays, miRNA, exon arrays and download eximioussoft banner maker full version Crack Key For U copy number data. Designed specifically for the needs of biologists, GeneSpring GX offers an interactive desktop computing environment that promotes investigation and enables understanding of microarray data within a biological context.
Make:Agilent Technologies
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: FlowJo is a software package that is capable of analyzing flow cytometry data. All files produced by assorted flow cytometers are written in the Flow Cytometry Standard format with an .fcs file extension. FlowJo will import and analyze cytometry data regardless of which FACS (Fluorescence Activated Cell Sorting) insrument/software is flowjo dongle replacement fee Free Activators to collect the data.
To use the Software please contact "Sandy" Ying-Sin Hsieh, who will explain how to download the software to your computer. The software access privileges are sometimes donglebased, and therefore will require you to sign-out for a dongle from PSC or come to some other arrangements with Flow-Jo.
Make:FlowJo
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: DeCyder 2-D Differential Analysis Software is specifically designed for 2-D fluorescence difference gel electrophoresis (DIGE) analysis and is a key element in the Ettan DIGE system (which we have). It is fullyully optimized and integrated to the 2-D DIGE platform.
Make:GE Healthcare Life Sciences
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: ImageMaster 2D software offers a flexible interface for the comprehensive visualization, flowjo dongle replacement fee Free Activators, exploration, and analysis of 2-D gel data from both 2-D DIGE (2-D fluorescence difference gel electrophoresis) and non-DIGE technologies. It is provided as altrenative to MacBooster Free Download use of Decyder 2D amalysis Software
Make:GE Healthcare Life Sciences
Form/Manual:ImageMaster 2D Proteomics Analysis Manual
Administrator:"Sandy" Ying Sin Hsieh or Sonja Young
Administrator Contact:
Application: The importance of sterilization is essential to good laboratory practice, particularly in biotechnology, pharmaceutical and clinical laboratories, flowjo dongle replacement fee Free Activators. Of all sterilization methods, high pressure steam (autoclave) is the most widely used because of its efficacy, speed and reliability. The department has a number of autoclaves, some run by steam and others use steam, but the steam is generated by water loaded into the autoclave and electricity.
Autoclaves are used in a wide variety of applications including:
• culture media preparation
• labware sterilization
• waste sterilization
Make:Steris/AMSCO
Administrator:Sonja Young
Administrator Contact:
Application: The importance of sterilization is essential to good laboratory practice, particularly in biotechnology, pharmaceutical and clinical laboratories. Of all sterilization methods, high pressure steam (autoclave) is the most widely used because of its efficacy, speed and reliability. The department has a number of autoclaves, some run by steam and others use steam, but the steam is generated by water loaded into the autoclave and electricity. Autoclaves are used in a wide variety of applications including:
• culture media preparation
• labware sterilization
• waste sterilization
Make: Sanyo, Hirayama, and New Brunswick
Administrator:Hyuk-Kyu Seoh
Administrator Contact:
Application: Thermo Electron offers the FRENCH Press and two models of FRENCH Pressure Cells for the disintegration of chloroplast materials, blood cells, unicellular organisms, flowjo dongle replacement fee Free Activators, homogenates of animal tissue and other biological particles. The pressure cell disrupts the cellular walls of a sample while leaving the cell nucleus undisturbed. This technique results in more uniform and complete disruption. The FRENCH Pressure Cell delivers higher pressures than bombs or decompression systems, without pre-treating the sample, flowjo dongle replacement fee Free Activators. Cells are lysed by forcing the cell or tissue suspension through a narrow space, thereby shearing the cell membraneøs.A French press consists of a piston that is used to apply high pressure to a sample volume of 40 to ml, forcing it through a tiny hole in the press. It can reach pressures of 20, pounds per square inch (psi).
Make: Thermo Electron
Form/Manual:French Press Operation Manual
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: The Sonifier® ultrasonic cell disruptors are versatile laboratory tools designed to apply high-frequency ultrasonic energy to biological and chemical processing to provide:
• Cell disruption
• Nano particles
• Emulsifications
• Homogenization
• Cell lysis
• Processing DNA & proteins
• Fine mixing
• Degassing
Make: Fisher / Emerson Industrial Automation
Form/Manual:Sonicator Tip Operations Manual
Administrator:Hyuk_Kyu Seoh
Administrator Contact: ()
Application: The Sonifier® ultrasonic cell disruptors are versatile laboratory tools designed to apply high-frequency ultrasonic energy to biological and chemical processing to provide:
• Cell disruption
• The bath adapter allows for the simultaneous sonication. didruption of cells surrounded by ice water, to • unify cell disruption
Make: Fisher / Emerson Industrial Automation
Form/Manual:Sonicator (Bath) Operations Manual
Administrator:George Pierce
Administrator Contact:
Application: This system allows for continuous temperature control constantly maintaining cell suspensions at a low temperature, flowjo dongle replacement fee Free Activators. It offers a controlled cell breakage rate, and direct steam sterilization and flushing with antiseptics (DynoMill brochure).
Make: DynoMill
Form/Manual:KDL Agitator Bead Mill Service Form
Administrator:Sonja Young
Administrator Contact:
Application: The particle’s settling velocity in centrifugation is a function of the particle’s size and shape, centrifugal acceleration, the volume fraction of solids present, the density difference between the particle and the liquid, and the viscosity. The Avanti J has a fast accel/decel rate and can process large volumes of solutions. The rate of separation depends on the rotor radius and type, flowjo dongle replacement fee Free Activators.
Make: Beckman
Form/Manual:Avanti J Floor Operation Manual
Administrator:Sonja Young
Administrator Contact:
Application: The particle’s settling velocity in centrifugation is a function of the particle’s size and shape, centrifugal acceleration, the volume fraction of solids present, the density difference between the particle and the liquid, and the viscosity. The Avanti J XP has a fast accel/decel rate and can process large volumes of solutions. The rate of separation depends on the rotor radius and type.
Make: Beckman
Form/Manual:Avanti J XP Floor Operation Manual
Administrator:Sonja Young
Administrator Contact:
Application: The particle’s settling velocity in centrifugation is a function of the particle’s size and shape, centrifugal acceleration, the volume fraction of solids present, the density difference between the particle and the liquid, and the viscosity. The Avanti J has a fast accel/decel rate and can process large volumes of solutions. The rate of separation depends on the rotor radius and type, flowjo dongle replacement fee Free Activators.
Make: Beckman
Form/Manual:Avanti J Floor Operation Manual
Administrator:Sonja Young
Administrator Contact:
Application: The particle’s settling velocity in centrifugation is a function of the particle’s size and shape, centrifugal acceleration, the volume fraction of solids present, flowjo dongle replacement fee Free Activators, the density difference between the particle and the liquid, and the viscosity. The Avanti JI has a fast accel/decel rate and can process large volumes of solutions. The rate of separation depends on the rotor radius and type.
Make: Beckman
Form/Manual:Avanti JI XP Floor Operation Manual
Administrator Contact:
Application: The Sorvall RC5B can process large volumes of solutions. The rate of separation depends on the rotor radius and type.
Make: Sorvall
Form/Manual:Operation Manual
Administrator:Sonja Young
Administrator Contact: ()
Application: Centrifuge R is a high speed, refigerated centrifuge for medium capacity needs. It allows for molecular applications in tubes up to mL and offers additional swing-bucket and fixed-angle rotors as well as deepwell plate capacity for increased versatility.
Make: Eppendorf
Form/Manual: Refrigerated Tabletop Operation Manual
Administrator:Sonja Young
Administrator Contact: ()
Application: Centrifuge and R are -high speed centrifuges for medium capacity needs. They allow for molecular applications in tubes up to mL and offer additional swing-bucket and fixed-angle rotors as well as deepwell plate capacity for flowjo dongle replacement fee Free Activators versatility.
Make: Eppendorf
Form/Manual: R Tabletop Operation Manual
Administrator:Sonja Young
Administrator Contact: ()
Application: The Centrifuge R combines the proven features of the Eppendorf microcentrifuges and the multipurposecentrifuges. They offer multiple application opportunities due to a high selection of different rotor types. Despite their compact size of approx. 35 cm width, special rotors for micro plates, 15 mL and 50 mL conical tubes can be easily used. Their incomparable versatility makes the Centrifuge and Centrifuge R flowjo dongle replacement fee Free Activators flagships under the Eppendorf microcentrifuges, flowjo dongle replacement fee Free Activators.
Make: Eppendorf
Form/Manual: R Tabletop Operation Manual
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: ÄKTA™Purifier and Explorer chromotography systems are designed for fast development and optimization of any biomolecular purification, using one working platform for all techniques and samples.
Applications: The method wizard and optimized system configurations, allows rapid media screening, method scouting, method optimization, and scaleup experiments. Standard system configurations are available to suit most purification needs, but are easily modified if required.
• Protein, peptide, nucleic acid purification in micro and gram scales
• Programmable sequential application of different columns up to 8
• Automated sample load up to 8 different samples or sequential load of samples
• Automated fraction collection in bulk or small fractions
• BufferPrep calculates and prepares the correct pH buffers
• Samples can be applied at flow rates up to 50 ml/min. and fractions can be collected without spillage at flow rates up to ml/min.
Make:GE Healthcare
Form/Manual:
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: ÄKTA™Pure chromotography systems are designed for the rapid development and optimization of biomolecular purification, flowjo dongle replacement fee Free Activators, using one working platform for all techniques and samples.
Applications: The method wizard and optimized system configurations, allows rapid media screening, flowjo dongle replacement fee Free Activators, method scouting, method optimization, and scaleup experiments. Standard system configurations are available to suit most purification needs, but are easily modified if required.
• Protein, peptide, nucleic acid purification in micro and gram scales
• Programmable sequential application of different columns up to 8
• Automated sample load up to 8 different samples or sequential load of samples
• Automated fraction collection in bulk or small fractions
• BufferPrep calculates and prepares the correct pH buffers
• Samples can be applied at flow rates up to 50 ml/min. and fractions can be collected without spillage at flow rates up to ml/min.
Further Information:GE Healthcare
Make:GE Healthcare
Form/Manual:
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application:ÄKTA™ Purifier and Explorer chromotography systems are designed for fast development and optimization of any biomolecular purification, using one working platform for all techniques and samples.
Applications: The method wizard and optimized system configurations, allows rapid media screening, method scouting, flowjo dongle replacement fee Free Activators, method optimization, and scaleup experiments. Standard system configurations are available to suit most purification needs, but are easily modified if required.
• Protein, peptide, nucleic acid purification in micro and gram scales
• Programmable sequential application of different columns up to 8
• Automated sample load up to 8 different samples or sequential load of samples
• Automated fraction collection in bulk or small fractions
• BufferPrep calculates and prepares the correct pH buffers
• Samples can be applied at flow rates up to 50 ml/min. and fractions can be collected without spillage at flow rates up to ml/min.
Make:GE Healthcare
Form/Manual:
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: ÄKTA start is an easy-to-use chromatography system that automates the rapid, manual purification procedures using small volume chromatography columns, for example HiTrap flowjo dongle replacement fee Free Activators Information:GE Healthcare
Make:GE Healthcare
Form/Manual:
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application:ÄKTA™Purifier and Explorer chromotography systems are designed for fast development and optimization of any biomolecular purification, using one working platform for all techniques and samples.
Applications: The method wizard and optimized system configurations, allows rapid media screening, method scouting, method optimization, flowjo dongle replacement fee Free Activators, and scaleup experiments. Standard system configurations are available to suit most purification needs, but are easily modified if required.
• Protein, peptide, nucleic acid purification in micro and gram scales
• Programmable sequential application of different columns up to 8
• Automated sample load up to 8 different samples or sequential load of samples
• Automated fraction collection in bulk or small fractions
• BufferPrep calculates and prepares the correct pH buffers
• Samples can be applied at flow rates up to 50 ml/min. and fractions can be collected without spillage at flow rates up to ml/min.
Make:GE Healthcare
Form/Manual:
Administrator:Hyuk Kyu Seoh
Administrator Contact: ()
Application: The MDQ is a capillary-based analytical system separates sample components within a fused-silica capillary, using one of several modes of electrophoresis.
Applications: Examples of the different modes of electrophoresis include:
• Capillary Zone Electrophoresis
• Micellar Electrokinetic Capillary Chromatography
• Capillary Gel Electrophoresis
• Capillary Isoelectric Focusing
• Capillary Electrochromatography.
The system includes a P/ACE MDQ configured with both a photo diode array and selectable-wavelength UV/Vis (,and nm filters included) detector, UV source optics, temperature-controlled sample storage module and 32 Karat™ Software. Typical applications are:
• Genetic analysis
• Chiral analysis
• Fast RNA purity analysis
• Basic drugs analysis
• Ion analysis
• Protein and Peptide analysis
Make: Beckman
Form/Manual: MDQ Service Form
Administrator: Hyuk Kyu Seoh
Administrator Contact:
Application: The Beckman HPLC has solvent delivery modules that are built with a rapid fill pump design that produce smooth flow from microbore to semi-preparative flow rates and thee high-pressure mixing design eliminates the need for constant helium sparging or degassing. The pumps are combined with high-sensitivity UV/VIS and diode array detectors and autosamplers. Flow range: - ml/min.; wavelength range: - nm; Maximum back pressure: 17 ul capacity flow cell; Programmable functions: wavelength, range, rise time, auto zero, event mark, relays, lamp off, peak detection, peak threshold, bandwidth and stop data.
Preparative HPLC refers to the process of isolation and purification of compounds. Important is the degree of solute purity and the throughput, which is the amount of compound produced per unit time. This differs from analytical HPLC, where the focus is to obtain information about the sample compound. Chemical Separations can be accomplished using HPLC by utilizing the fact that certain compounds have different flowjo dongle replacement fee Free Activators rates given a particular column and mobile phase. Each compound should have a characteristic peak under certain chromatographic conditions. Depending on what needs to be separated and how closely related the samples are, the chromatographer may choose the conditions, such as the proper mobile phase, to allow flowjo dongle replacement fee Free Activators separation in order to collect or extract the desired compound as it elutes from the stationary phase. With these characteristic peaks, identification of compounds can be done. HPLC also allows for quantification of compounds by determining the unknown concentration of a compound in a known solution.
Make: Beckman
Form/Manual: HPLC Service Form
Administrator:Sonja Young
Administrator Contact: ()
Application: The Concentrator plus from Eppendorf is available in two configurations:
Complete system with an integrated service-free diaphragm pump
Basic concentrator for connecting to an existing vacuum.
The Concentrator’s heating technology optimizes the evaporation process. No matter which configuration you choose, you’re assured of quick and efficient—yet gentle—vacuum concentration of your samples (e.g. DNA/RNA, proteins).
The complete system includes a vapour condenser that purifies the exhaust air by up to 85%. This serves as protection against unpleasant vapours.
Make:Eppendorf
Form/Manual: Speed Vac Concentrator Operation Manual
Administrator:Sonja Young
Administrator Contact:
Application: The Vacufuge Concentrator is a complete system with solvent-resistant PTFE vacuum flowjo dongle replacement fee Free Activators and vapor trap. Narrow, inch width saves valuable bench space. Motorless drive and sealed chamber provide trouble-free operation Evaporation Modes:
• Choice of three (aqueous, alcohol, off) to correspond with sample solvent and reduce processing time up to 20%.
• Maximize evaporation efficiency and prolong pump lifespan by periodically aerating the vacuum line, preventing condensation build-up.
Automatic vacuum release prevents sample loss from bumping and foaming. Brake feature brings rotor to a faster stop—allows quick access to samples. Choice of four heating levels (30°C, 45°C, 60°C, and ambient) allows safe and efficient concentration of a variety of samples. Besides the microfuge tube rotor, there is a micro plate rotor available upon request (see Debby).
Make:Eppendorf
Form/Manual: Vacufuge Operation Manual
Administrator:Ping Jiang
Administrator Contact: ()
Application:The capillary xl DNA Analyzer is the Gold Standard for high throughput genetic analysis. Use this for DNA fragment analysis applications such as microsatellites, AFLP, SNP analysis, mutation detection and traditional DNA sequencing. Get the highest quality data at flowjo dongle replacement fee Free Activators low cost per sample.
• Higher optical sensitivity and advanced polymers enable you to obtain higher-quality sequencing data for less.
• Multiple automation features decrease costly human errors.
• Optimized polymers increase your productivity without compromising your results.
• Perform a wide variety of sequencing and fragment analysis applications including resequencing, microsatellite analysis, AFLP, LOH, SSCP, SNP screening and SNP validation.
Make:Life Technologies
For Use and Further Information: DNA Sequencing Services
Administrator:Ping Jiang / Sonja Young
Administrator Contact: ()
Application: The Ion OneTouch™ 2 System simplifies the workflows for the Ion Proton™ and Ion PGM™ systems by providing an automated solution for scalable and reproducible template preparation. The Ion OneTouch™ 2 System: • Integrates multiple manual template preparation workflows into a single system
• Enables parallel processing of multiple samples per day through modular design
• Supports scalable template preparation for all Ion semiconductor sequencing chips
• Supports up to bases on the Ion PGM™ System and up to bases on the Ion Proton™ System*
• Includes a full thermal cycling modality for amplification for quick optimization of thermal cycling parameters
• Employs a peristaltic pump fluidic system install ubuntu from usb windows 7 Free Activators eliminates the need for gas
• Fits easily on any benchtop with its small instrument footprint
Make: Life Technologies (Thermofisher)
For Use and Further Information: DNA Sequencing Services
Administrator:Ping Jiang / Sonja Young
Administrator Contact: ()
Application: The IonS5 System combines semiconductor sequencing technology with natural biochemistry to directly translate chemical information into digital data, democratizing sequencing and making it accessible to virtually any lab or clinic. The Ion GeneStudio S5 Series is flexibly flowjo dongle replacement fee Free Activators to enable a broad range of targeted NGS RNA/DNA sequence applications with industry-leading speed and scalability. Select from five different sequencing chips to sequence a throughput range from 2M to M reads per run. Simply choose the chip size and the instrument that matches your throughput and application needs.
Make: Life Technologies (Thermofisher)
For Use and Further Information: DNA Sequencing Services
Administrator:Ping Jiang / Sonja Young
Administrator Contact: ()
Application: The Ion Chef™ System is the next generation of workflow simplification products for the Ion Proton™ and Ion PGM™ systems, flowjo dongle replacement fee Free Activators. The Ion Chef™ System provides automated, high-throughput template preparation and reproducible chip loading for users at any experience level. With typically less than 15 minutes of hands-on time, an intuitive touch-screen interface, and significantly flowjo dongle replacement fee Free Activators productivity than the Ion OneTouch™ 2 System, the Ion Chef™ System makes the Ion Torrent™ sequencing workflow accessible for every lab.
Make: Life Technologies (Thermofisher)
For Use and Further Information: DNA Sequencing Services
Administrator:Ping Jiang / Sonja Young
Administrator Contact: ()
Application: The Ion Proton™ System offers a complete workflow from sample through analysis, flowjo dongle replacement fee Free Activators, and variant calling or RNA analysis. It is used with the Ion Chef™ System* to enable automated, high-throughput template preparation and reproducible chip loading for users of any experience level. Built for speed, the Ion Proton™ System provides sequencing run times from 2–4 hours on the Ion PI™ Chip, taking you from DNA to variants in a single day. It is equipped with Ion Reporter™ Software, providing integrated tools for tertiary data analysis for DNA variation analysis across single, paired, or trio research samples.
Make: Life Technologies (Thermofisher)
For Use and Further Information: DNA Sequencing Services
Administrator:Sonja Young
Administrator Contact: ()
Application: The nCounter SPRINT platform is capable of degitally analyzing multiple pathways in a single tube in an extraction-free workflow requiring only 10 minutes of hands-on time -significantly benefiting your RNA, DNA, and protein profiling applications.
Make: Nanostring Technologies
For Use and Further Information:
For Basic Use Capabilities:Online Information
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact:
Application: This system lets you enhance resolution by kaspersky rescue disk 2018 usb Activators Patch two blocks of running conditions to be executed successively. The CHEF-DR II system is optimized for the most popular range of separations with a fixed angle of °. This unit can be used for separations of fragments up to 6 Mb in size by adjusting the running conditions for low voltage and extended run times. Besides mapping, this system can be used for:
• Strain typing-molecular epidemiology
• Apoptosis assays
• DNA damage and repair studies
• Large protein separations
Pulsed Field Gel Electrophoresis Is Still the Benchmark for Mapping Applications such as: • Disease locus mapping
• YAC, BAC, PAC, and cosmid mapping
• Chromosome rearrangements
• RFLP and DNA fingerprinting
Make: BioRad
Form/Manual:CHEF DR II Pulse Wave
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: Simple Western by ProteinSimple effectivley reinvents the entire Western blot process without gels, transfer tanks, blots or film - finally giving researchers a complete, walk-away solution for protein detection and characterization. All hands-on steps from sample loading and detection to quantitative data analysis are completely automated, flowjo dongle replacement fee Free Activators, eliminating the manual factors that can negatively impact reproducibility, quantitation, time to result and data reliability. Simon analyzes 12 samples per run in hours! Funding provided by Tech fee.
Make: Flowjo dongle replacement fee Free Activators Simple
Form/Manual: Protein Simple Simon Western
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application:T he Gene Pulser Xcell™ system is a modular electroporation system for transfecting every cell type. The system includes a main unit, a ShockPod™ cuvette chamber, and your choice of accessory modules: the capacitance extender (CE module) and the pulse controller (PC module).
Features and Benefits:
• Universal electroporation — transfects all cell types, from primary and stem cells to bacteria and yeast
• Preset protocols — include the most common mammalian and bacterial cell types
• Flexibility — choice of programs for preset protocols, optimization protocols, manual operation, and/or user protocols
• Protocol library — collection of electroporation protocols for every cell type including primary, • immortal, and bacterial cells
• Data management — enables storage and recall of parameters used in the previous experiments, flowjo dongle replacement fee Free Activators, useful for troubleshooting
• Reproducibility — uses PulseTrac™ circuitry and arc-protection features to ensure reproducibility and sample protection
Make: BioRad
Form/Manual: Gene Pulser Xcell
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: The MicroPulser electroporator is a simple yet versatile instrument that enables safe and reproducible transformation of bacteria, yeast, and other microorganisms. Transformation efficiencies much higher than those obtained with chemical methods can be achieved.
Key Features:
• One-button pulse delivery, attached cuvette chamber, and rapid charge time for fast sample handling
• Preset, flowjo dongle replacement fee Free Activators, optimized programs for commonly studied bacteria and fungi allow rapid program selection
• Arc quenching (ARQ) system significantly reduces arcing, protecting against loss of valuable Designs Crack Key For U • Broad range of parameters for manual optimization. Manual programming allows voltage to be selected • in a –3, V range with 10 V precision and allows pulse width to be selected in a – ms range with ms precision
• High-voltage 3, V capability yields improved efficiency in larger-volume cuvettes
• Compact, space-saving design
• Audible and visible pulse indicators
• Time constant and actual volts displayed to monitor reproducibility
Make: BioRad
Form/Manual: Micropulser Operation Manual
Administrator:Sonja Young
Administrator Contact: ()
Application: The X-OMAT A processes exposed radiographic film. The exposed film sheet is placed into an automatic film processor. The film is processed via rollers through tanks containing developer and fixer solutions, and finally through a wash system. The developed film emerges from the processor ready for reading by the researcher.
Make: Kodak
Form/Manual: X-Omat A Operation Manual
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: The BD Accuri™ C6 is a personal flow cytometer that is easy to use, simple to maintain, and affordable. The analytical power and versatility of today’s laser-based flow cytometry systems have unlocked the mysteries of cell biology and empowered entirely new fields of research. As a result, flow cytometry has become a staple of modern laboratories around the world.
Make:BD Biosciences
Form/Manual: Accuri C-6 Blue/Red
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: This benchtop system delivers high-speed sorting and multicolor analysis. The BD FACSAria instrument is the first benchtop sorter that incorporates a fixed-alignment cuvette flow cell, which minimizes startup time and improves reproducibility. This new flow flowjo dongle replacement fee Free Activators provides superior fluorescence sensitivity and freedom from instrument maintenance and alignment. Gel coupling to flowjo dongle replacement fee Free Activators objective lens improves collection efficiency and increases sensitivity and resolution needed ofr multicolor sorting applications. Additional "Sort setup" and "sort monitoring" features in the system software makes the BD FACSAria instrument easy to use. BD FACS™ Accudrop technology is integrated into the system for quick and accurate drop-delay determination. Stream monitoring of the breakoff point and clog detection are iobit driver booster pro Activators Patch. The system has four air-cooled lasers at nm, nm, nm and nm wavelengths. Two- and four-way bulk sorting devices for a variety of tube sizes are flowjo dongle replacement fee Free Activators available. Water Flowjo dongle replacement fee Free Activators tube holders are also available to keep cells warm or cold as needed.
Applications are far reaching and can be found on the BD online tutorial.
Make:BD Biosciences
For Use and Further Information: Flow Cytometry and Cell Sorting Services
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: Built on more than 25 years of BD experience and leadership in flow cytometry and multicolor analysis, the BD FACSCanto™ II system is an easy-to-use benchtop analyzer that delivers proven performance, accuracy, and high-quality results.
The BD FACSCanto II provides the ultimate in flexibility How to Hack Filmora Registration Code to Permanently Activate can be configured with two or three lasers to detect up to eight colors.*
Applications are far reaching and can be found on the BD online tutorial.
Make:BD Biosciences
For Use and Further Information: Flow Cytometry flowjo dongle replacement fee Free Activators Cell Sorting Services
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: The Auto utilizes bright field imaging and dual-fluorescence imaging to quickly and accurately identify and count individual cells. Cell count, concentration, diameter, and % viability are automatically calculated and reported.
Make:Nexcelom
Form/Manual: Cellometer Cell Counter
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: The BD LSRFortessa™ cell analyzer offers the ultimate in choice for flow cytometry, providing power, performance, and consistency. Designed to be affordable and expandable, the BD LSRFortessa has the flexibility to support the expanding needs of multicolor flow cytometry assays.
The Fortessa is configurable and upgradeable with up to 4 lasers to detect up to 18 colors simultaneously, BD LSR analyzers feature innovative designs for both the excitation optics and collection optics that reduce excitation losses and improve light collection efficiency. Our instrument has blue ( nm), red ( nm),yellow-green ( nm) and violet (nm) lasers. The addition of the yellow-green laser allows use of the new fruit fluorescent proteins such as mCherry. It flowjo dongle replacement fee Free Activators limits spectral overlap between FITC and PE – 2 of the most common fluorescent markers used in flow cytometry.
Applications are far reaching and can be found on the BD online tutorial.
Make:BD Biosciences
For Use and Further Information: Flow Cytometry and Cell Sorting Services
Administrator: Sonja Young and "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: Maintain viable stocks and strains at °C
Make: Thermo
Form/Manual: Freezer Manual
Administrator:Sonja Young and Hyuk Kyu Seoh
Administrator Contact: and
Application: Sublimation flowjo dongle replacement fee Free Activators when a frozen sample goes directly to the gaseous phase without passing through the liquid phase. As the ice sublimates, it leaves voids in the dry residual material making it easy to rehydrate. Freeze drying samples stabilizes them for storage, preservation, or shipping. Many times, drying causes damage and some loss of cellular or protein activity. Lyophilization is a method of sample preservation that significantly reduces damage to biological samples. Substances that are not damaged by freezing can usually be lyophilized so that refrigerated storage is unnecessary. Important exceptions are mammalian cells, nearly all of which are destroyed by lyophilization. However, many microorganisms and proteins survive lyophilization well, and it is a preferred method of drying vaccines, pharmaceuticals, blood fractions, and other laboratory samples. Some specialist food products are also lyophilized.
Make: Virtis
Form/Manual: BT EL Lyophilizer Tabletop Service Form
Administrator:Sonja Young and Hyuk Kyu Seoh
Administrator Contact: ()
Application: Sublimation occurs when a frozen sample goes directly to the gaseous phase without passing through the liquid phase. As the ice sublimates, it leaves voids in the dry residual material making it easy to rehydrate. Freeze drying samples stabilizes them for storage, preservation, or shipping. Many times, drying causes damage and some loss of cellular or protein activity. Flowjo dongle replacement fee Free Activators is a method of sample preservation that significantly reduces damage to biological samples. Substances that are not damaged by freezing can usually be lyophilized so that refrigerated storage is unnecessary. Important exceptions are mammalian cells, nearly all of which are destroyed by lyophilization. However, many microorganisms and proteins survive lyophilization well, and it is a preferred method of drying vaccines, pharmaceuticals, blood fractions, and other laboratory samples. Some specialist food products are also lyophilized.
Make: LabConco
Form/Manual: Freezone Large Service Form
Administrator:Sonja Young and Hyuk Kyu Seoh
Administrator Contact: ()
Application: Sublimation occurs when a frozen sample goes directly to the gaseous phase without passing through the liquid phase. As the ice sublimates, it leaves voids in the dry residual material making it easy to rehydrate. Freeze drying samples stabilizes them for storage, preservation, or shipping. Many times, drying causes damage and some loss of cellular or protein activity. Lyophilization is a method of sample preservation that significantly reduces damage to biological samples. Substances that are not damaged by freezing can usually be lyophilized so that refrigerated storage is unnecessary. Important exceptions are mammalian cells, nearly all of which are destroyed by lyophilization. However, many microorganisms and proteins survive lyophilization well, and it is a preferred method of drying vaccines, pharmaceuticals, blood fractions, and other laboratory samples. Some specialist food products are also lyophilized.
Make: LabConco
Form/Manual: Freezone Large Service Form
Administrator:Sonja Young
Administrator Contact: ()
Application: Leveraging technologies adapted from the semiconductor industry, Affymetrix, the principle manufacture of GeneChip arrays uses photolithography and solid-phase chemistry to produce arrays containing hundreds of thousands of oligonucleotide probes packed at extremely high densities. The probes are designed to maximize sensitivity, specificity, and reproducibility, allowing consistent discrimination between specific and background signals, and between closely related target sequences.
Attesting to their powerful capabilities, GeneChip arrays are applied in a wide variety of DNA and mRNA analyses. Recent analytical accomplishments include the elucidation of interactions between signaling pathways involved in development, the discovery of a new class of leukemia, and the development of new assays to track drug metabolism.
Make: LabConco
Form/Manual: Freeze Dry System 4 Small Service Form
Administrator:Sonja Young and Hyuk Kyu Seoh
Administrator Contact: ()
Application: Leveraging technologies adapted from the semiconductor industry, Affymetrix, the principle manufacture of GeneChip arrays uses photolithography and solid-phase chemistry to produce arrays containing hundreds of thousands of oligonucleotide probes packed at extremely high densities. The Ghost Browser 2.1.0.6 Full version Crack Key For U are designed to maximize sensitivity, specificity, and reproducibility, allowing consistent discrimination between specific and background signals, and between closely related target sequences.
Attesting to their powerful capabilities, GeneChip arrays are applied in a wide variety of DNA and mRNA analyses, flowjo dongle replacement fee Free Activators. Recent analytical accomplishments include the elucidation of interactions between signaling pathways involved in development, the discovery of a new class of leukemia, and the development of new assays to track drug metabolism.
Make: LabConco
Form/Manual: Lyophilizer Small Service Form
Administrator: Sonja Young
Administrator Contact: ()
Application: Leveraging technologies adapted from the semiconductor industry, Affymetrix, the principle manufacture of Flowjo dongle replacement fee Free Activators arrays uses photolithography and solid-phase chemistry to produce arrays containing hundreds of thousands of oligonucleotide probes packed at extremely high densities. The probes are designed to maximize sensitivity, specificity, and reproducibility, allowing consistent discrimination between specific and background signals, and between closely related target sequences.
Attesting to their powerful capabilities, GeneChip arrays are applied in a wide variety of DNA and mRNA flowjo dongle replacement fee Free Activators. Recent analytical accomplishments include the elucidation of interactions between signaling pathways involved in development, the discovery of a new class of leukemia, flowjo dongle replacement fee Free Activators, and the development of new assays to track drug metabolism.
Make: LabConco
Form/Manual: Lyophilizer Small with Dry Ice Tap Flowjo dongle replacement fee Free Activators Form
Administrator: Sonja Young
Administrator Contact: ()
Application: Model Gel Dryer allows the drying of acrylamide and other gel types.
The Model gel dryer has a 35 x 45 cm drying surface, which is large enough to fit up to 16 mini gels, 9 Criterion gels, 2 large format gels, or 1 sequencing gel.
Make: BioRad
Form/Manual:
Administrator:Sonja Young
Administrator Contact: ()
Application: Leveraging technologies adapted from the semiconductor industry, Affymetrix, the principle manufacture of GeneChip arrays uses photolithography and solid-phase chemistry to produce arrays containing hundreds of thousands of oligonucleotide probes packed at extremely high densities. The probes are designed to maximize sensitivity, specificity, and reproducibility, allowing consistent discrimination between specific and background signals, and between closely related target sequences.
Attesting to their powerful capabilities, GeneChip arrays are applied in a wide variety of DNA and mRNA analyses. Recent analytical accomplishments include the elucidation of interactions between signaling pathways involved in development, the discovery of a new class of leukemia, and the development of new assays to track flowjo dongle replacement fee Free Activators metabolism.
Make: Affymetrix
For Use and Further Information: Genomics Microarray Services
Administrator:Sonja Young
Administrator Contact: ()
Application: The GeneChip® Fluidics Station is used for the wash and stain operation of Affymetrix GeneChip® arrays. The instrument includes design advancements to provide improved ease of use and true walk-away freedom dramatically improving efficiency in your genetic analysis.
Make: Affymetrix
For Use and Further Information: Genomics Microarray Services
Administrator:Sonja Young
Administrator Contact: ()
Application: GeneChip® Hybridization Oven provides uniform hybridization environmment for consistent RNA : chip bound DNA interactions, allowing for appropriate discrimination between specific and background signals, and between closely related target sequences.
Make: Affymetrix
For Use and Further Information: Genomics Microarray Services
Administrator: Chung Dar Lu and P.C. Tai
Administrator Contact: ()
Application: DNA Microarrays and Proteomic Technologies allow scientists to detect genes or proteins that are coregulated and whose patterns of change correlate with something important such as a disease state. However there is no assurance that these changes are really significant to the cell. Phenotype MicroArrays are a complementary technology providing the needed information at the cellular level and much more. After a genetic change or exposure to a drug lead, the researcher can directly evaluate the cellular response to that change. Phenotype MicroArrays can monitor, flowjo dongle replacement fee Free Activators, either directly or indirectly, most known aspects of cell function. The range of phenotypes includes:
• Cell surface structure and transport functions
• Catabolism of carbon, nitrogen, phosphorus, and sulfur
• Biosynthesis of small molecules
• Synthesis and function of macromolecules and cellular machinery
• Cellular respiratory functions
• Stress and repair functions
• Other cellular properties
Make: Biolog
Form/Manual: Biolog Phenotype Microarray
Administrator:Sonja Young
Administrator Contact: ()
Application: The popular GenePix® B Microarray Scanner has earned its outstanding reputation due to its incredible, intuitive, and reliable operation. Our commitment to engineering excellence guarantees that the GenePix B Microarray Scanner remains the benchmark in microarray scanning technology. In we updated the electronics to provide a state-of-the-art microarray scanner with the finest quality components while maintaining the features and performance that you have become accustomed to.
Make: Molecular Devices
Form/Manual: GenePix MicroArray Scanner
Administrator:Sonja Young
Administrator Contact: ()
Application: The Histocenter 3 embeds tissue samples into paraffin blocks for microtome sectioning.
Make: Shandon
Form/Manual: Histocentre 3
Administrator:Sonja Young
Application: The HM Microtome esnures that sectioning of paraffin blocks into extremely thin slices proceeds at an optimal sectioning temperature
Make: Fisher
Form/Manual: HM Microtome
Administrator:Sonja Young
Application: This microtome sections paraffin blocks into extremely thin slices using a sliding motion
Make: bilin.com.mx
Form/Manual: Microtome Model 86C Sliding
Administrator:Sonja Young
Administrator Contact: ()
Application: This microtome sections paraffin blocks into extremely thin slices using a sliding motion
Make: Unknown
Form/Manual: Rotory Microtome Service Form
Administrator:Ping Jiang
Administrator Contact:
Application: The Bioanalyzer provides for a rapid visualisation of sample quality and quantity. High sensitivity with minimal sample quantities. Significant time savings - up to12 samples in 30 minutes. Reduced use and waste of hazardous chemicals.
Make: Agilent
Form/Manual: Bioanalyzer
Administrator:Ping Jiang
Administrator Contact:
Application: The Qubit™ Fluorometer is the next generation of the popular benchtop fluorometer that accurately measures DNA, RNA, and protein using the highly sensitive Qubit quantitation assays. The concentration of the target molecule in the sample is reported by a fluorescent dye that emits a signal only when bound to to the target, which minimizes the effects of contaminants—including degraded DNA or RNA—on the result. The easy-to-use touch screen menus make it easy to select and run the assays you need, with results displayed in just a few seconds Key features of the Qubit Fluorometer include: Powerful, dual-core processor quickly and accurately quantifies DNA, RNA, and protein, in less than 5 seconds per sample Uses as little as 1 μL of sample Stores up to 1, sample results Large inch state-of-the-art color touch screen for easy workflow navigation Ability to drive snapshot raid Free Activators your Qubit Fluorometer with the assays you run most, add new assays, or even create your own with MyQubit
Make:Thermofisher
Form/Manual: Qubit 3 Fluorometer
Administrator:Hyuk-Kyu Seoh
Administrator Contact:
Application: Exceptional sensitivity for quantitation of biomolecules labeled with chemiluminescent probes Supports gel documentation of Coomassie™ blue and silver-stained samples. Accurate quantitation of closely spaced bands in complex protein samples for gels and films up to 18 x 12 cm. Low noise for longer exposure times and lower background, important for precise quantitation of very weak signals. Wide linear dynamic range for precise quantitation of faint and dark bands over four orders of magnitude in the same image, avoiding time-consuming multiple film exposures. Distortion, dark frame, and flat frame corrections are applied to each imaging mode for optimal precision and uniform quantitation. Sensitive detection of less than 40 pg of protein on a Western blot. Sensitivity may be increased by flowjo dongle replacement fee Free Activators of up to 8 x 8 pixels and smoothing, flowjo dongle replacement fee Free Activators. Chemiluminescent and colorimetric signals can be captured in the same image without changing the lens.
Make: GE Healthcare
Form/Manual: LAS mini Chemiluminescence
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact:
Application: Amersham Iobit uninstaller 8.5 crack Activators Patch is a sensitive and robust chemiluminescence imager for high-resolution digital imaging of protein and DNA samples in gels and membranes. Flowjo dongle replacement fee Free Activators operation: You can operate the instrument from a tablet computer with easy-to-use image analysis software. No prior imager experience or training is required to obtain high-quality results. Excellent performance: Advanced optics provides high-resolution images, high sensitivity, and broad dynamic range. Robustness: An optimal instrument for multi-user labs.
Make: GE Healthcare
Form: LAS mini Chemiluminescence Service Form
Administrator:Sonja Flowjo dongle replacement fee Free Activators Contact:
Application: Some applications on the Omega 10g are SYBR Green stained flowjo dongle replacement fee Free Activators and GFP expressed experiments and Qdot multi-plexed western blots. The instrument has megapixel resolution, touch pad control panel, adjustable height sample tray, variable intensity UV Transilluminator and multi-wavelength LED Epi-Illumination.
Make: Ultra Lum
Form/Manual:Omega 10g
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact:
Application: The Luminex MagPix System has been recently purchased (Summer'19). It belongs to a family of Flow cytometric systems enables you to multiplex (simultaneously measure) up to 50 analytes in a single microplate well, using very small samples. The MAGPIX system's imaging capapbility is based on a CCD technology that allows for it to be a more compact, robust system. It’s also easy to operate and maintain with streamlined start-up and shutdown protocols and minimal maintenance requirements, flowjo dongle replacement fee Free Activators, delivering fast and cost-effective bioassay results on many assay formats including nucleic acid assays, receptor-ligand assays, immunoassays, and enzymatic assays.
Make: Luminex
Form/Manual/website:MAGPIX System
Administrator: Sonja Young
Administrator Contact:
Application: Non-Fluorescent & Colorimetric Gels: Coomassie Blue, Silver stain, Autorad film, colony plates and Fluorescent Gels. This self-contained gel imaging system features a scientific grade megapixel CCD camera for capturing high resolution images with simple yet versatile capture and save options. Screen tilts to optimum viewing angle. A built-in computer touch screen supplies a complete system at one location for fluorescent and colorimetric imaging, while the attached comp.
NO ETHIDIUM BROMIDE is to be used in this instrument
Make: UVP
Form/Manual:UVP old EtBr OK Service Form
Administrator: Sonja Young
Administrator Contact:
Application: Non-Fluorescent & Colorimetric Gels: Coomassie Blue, Silver stain, Autorad film, colony plates and Fluorescent Gels. This self-contained gel imaging system features a scientific grade megapixel CCD camera for capturing high resolution images with simple yet versatile capture and save options. Screen tilts to optimum viewing angle. A built-in computer touch screen supplies a complete system at one location for fluorescent and colorimetric imaging.
Make: UVP
Form/Manual:UVP EtBr OK
Administrator: Sonja Young
Administrator Contact:
Application: Non-Fluorescent & Colorimetric Gels: Coomassie Blue, Silver stain, colony plates and Fluorescent Gels. InGenius3 is a self-contained, low budget gel documentation and analysis fluorescence applications. It features a compact darkroom which has a sliding front door and an internal LED white light. InGenius3 has a 3m pixel camera and can produce images with 16 bit image depth. A manual zoom lens and manual filter drawer (includes a UV filter) completes the package.
Make: Syngene
Form:UVP EtBr OK Service Form
Administrator: Hyuk-Kyu Seoh and "Sandy" Ying-Sin Hsieh
Administrator Contact: or
Application: The Typhoon is an older version fo the TyphoonTrio, and can image store phosphor autoradiography and many types of fluorescent stains (direct blue-excited fluorescence – and nm; direct green-excited fluorescence – nm; direct red-excited fluorescence – nm. This imager is specifically designed for 2-D DIGE multicolor scanning and detection of CyDye DIGE Fluor dye-labeled proteins. Other common fluorescent stains that this imagers can image are Deep Purple, Coomasie Blue, EtBr, SYPRO red and SYPRO Ruby. They can image agarose and acrylamide gels, blots, microarray slides and imaging plates of many different sizes.
Make: GE Healthcare
Form/Manual:Typhoon Phospho/ Fluorescent
Administrator: Sonja Young
Administrator Contact: ()
Application: Key RSDP Features of FluorChem Imaging System
• Resolution: Megapixel CCD resolution: Megapixels
• Proprietary algorithms for 3D image contour, image sharpening, and noise reduction for improved image resolution and quality.
• Sensitivity: Deep CCD peltier cooling facilitates multiple hour long exposures and exceptional image quality.
• FluorChem as an optimized for CCD imaging technology to generate femtogram sensitivity levels.
• Dynamic Range: > O.D. dynamic range with FluorChem Imaging System.
• Performance: Fast, easy, versatile, and powerful for comprehensive fluorescence and chemiluminescence applications AND basic gel documentation.
• Automatic lane/band detection and analysis with smiling corrections are easily done with a single button click!
• Capture grayscale or true color images with automatic RGB color image overlay feature.
Make: Bucher biotec
Form/Manual:Alpha Innotech Imaging Systems Manual
Administrator:Sonja Young
Administrator Contact: ()
Application: Culture and Cell Incubation
Make:Thermo-Fisher
Form/Manual:Incubator
Administrator: Sonja Young
Administrator Contact: ()
Application: The classic C25 incubator shakers are large capacity shakers utilizing an eccentric counter balanced drive to provide horizontal plane rotary motion in a 1" ( cm) circular orbit. Shaker speed and temperature are precisely regulated by a microprocessor controller that maintains setpoints within very rigid tolerances. Touch the keypad to select and display temperatures from a few degrees above ambient to 60º (Model C25), and 17º below ambient (minimum +4º) to 60º, (Model C25KC).
Make:New Brunswick
Form/Manual:Shaker, C25 Floor
Administrator: Sonja Young
Administrator Contact: ()
Application: The Series 25 incubator shakers are medium to large capacity shakers whose shaker speed and temperature are precisely regulated by a microprocessor controller that maintains setpoints within very rigid tolerances. Touch the keypad to select and display temperatures from a few degrees above ambient to 60º (Model Series 25), and 17º below ambient (minimum +4º) to 60º, (Model Series 25KC). NB. Even though this particular Shaker is well able to regulate it's temperature it NEEDS an additional thermometer to view temperature within the cabinet
Make:New Brunswick
Form/Manual:Shaker, Series 25 Floor
Administrator:Sonja Young
Administrator Contact: ()
Application: New Brunswick Floor Incubator Shakers E25R offers the largest capacity (flasks up to 6 L) in the Excella® line for flowjo dongle replacement fee Free Activators, incubating, and optional cooling. Choose from standard ambient models or refrigerated models that operate at 15°C below ambient to 60°C. The reliable microprocessor control system enables precise setting of speed, running time and temperature flowjo dongle replacement fee Free Activators automatically compensates for changes in load, voltage or temperature. - See more flowjo dongle replacement fee Free Activators bilin.com.mx#bilin.com.mx
Make: New Brunswick
Form/Manual:Shaker, E25 Floor
Administrator: Sonja Young
Administrator Contact: ()
Application: The classic incubator shakers are large capacity shakers utilizing an eccentric counter balanced drive to provide horizontal plane rotary motion in a 1" ( cm) circular orbit. Shaker speed and temperature are precisely regulated by a microprocessor controller that maintains setpoints within very rigid tolerances. Touch the keypad to select and display temperatures from a few degrees above ambient to 60º (Model C25), and 17º below ambient (minimum +4º) to 60º, (Model C25KC).
Make:New Brunswick
Form/Manual:Shaker, Classic Floor
Administrator: Sonja Young and "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application:Thermo Scientific™ MaxQ shakers are versatile incubated/refrigerated units featuring a easy side access drain system making cleaning spills easy and retractable foot casters to easily position the shaker in the lab. MaxQ incubated and refrigerated floor shakers feature a foot pedal for hands-free operation and a large slanted viewing window to check the progress. These shakers are ideal for cell culture, solubility studies, plasmid purification, staining and destaining, extraction procedures, protein expression and many other applications
Make:Thermo Scientific
Form/Manual:Shaker, MaxQ Floor/Refrig Service Form
Administrator: Sonja Young
Administrator Contact: ()
Application: Large-capacity, environmental shakers for incubation and/or refrigeration.
• Wide temperature range
• Uniform temperature, regardless of sample location
• Rapid temperature equilibration
Make:New Brunswick
Form/Manual:Shaker, Innova Floor
Administrator: Sonja Young and "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: Features a heavy-duty drive and cool-running motor for long life and quiet operation under heavier loads and higher speeds.
Intuitive, spill-proof keypad allows easy input of parameters
in. (cm) LED display shows running conditions and diagnostics (all models except E1)
UniCentric™ drive and brushless DC motor ensure quiet, vibration-free operation
Versatile—use same accessories as other New Brunswick Scientific shakers
Two-year warranty on parts and labor (US and Canada only)
Make:New Brunswick
Form/Manual:Shaker C24 Tabletop
Administrator: Sonja Young and "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application:The E24 / E25 shakers combine incubated/refrigerated temperatures with orbital shaking in a compact footprint. They use minimal bench space and are affordably priced. These benchtop shakers are ideal for cell culture, solubility studies, extraction procedures, protein expression and many other applications
Make:New Brunswick
Form/Manual:Shaker E24 Tabletop
Administrator: Sonja Young and "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: Thermo Scientific™ MaxQ is a versatile, incubated and refrigerated shaker ideal for incubating a small number of vessels.
The MaxQ shakers combine incubated/refrigerated temperatures with orbital shaking in a compact footprint. They use minimal bench space and are affordably priced. These benchtop shakers are ideal for cell culture, solubility studies, extraction procedures, protein expression and many other applications
Make:Thermo Scientific
Form/Manual:Shaker MaxQ Tabletop
Administrator: Sonja Young
Administrator Contact: ()
Application: Thermo Scientific™ Mini is a versatile, incubated and refrigerated shaker ideal for incubating a small number of vessels. The Mini shakers combine incubated/refrigerated temperatures with orbital shaking in a compact footprint. They use minimal bench space and are affordably priced. These benchtop shakers are ideal for small cell culture, solubility studies, extraction procedures, protein expression and many other applications
Make:Thermo Scientific
Form/Manual:Mini Q Shaker Tabletop
Administrator: Sonja Young
Administrator Contact: ()
Application: Open air benchtop shakers are ideal for small cell culture, solubility studies, extraction procedures, protein expression and many other applications
Make:Thermo Scientific
Form/Manual:Rotating Shaker MaxQ
Administrator: Sonja Young
Administrator Contact: ()
Application: Sterilize glassware and other high temperatre needs
Make:Thermo-Fisher
Form/Manual:Oven Tabletop
Administrator: Sonja Young
Administrator Contact: ()
Application: Thermo-Fisher chamber furnaces are ideal for use in crowded laboratories and for common applications such as materials testing, burning, rapid heat processes.
Make:Thermo-Fisher
Form/Manual:
Administrator: "Sandy" Ying Sin Hsieh or John Houghton
Administrator Contact: () or ()
Application: The AFM is one of the foremost tools for imaging, measuring, flowjo dongle replacement fee Free Activators, and manipulating matter at the nanoscale. The information is gathered by "scanning" the surface on which the biological samples is based with a mechanical probe. Piezoelectric elements that flowjo dongle replacement fee Free Activators tiny but accurate and precise movements flowjo dongle replacement fee Free Activators (electronic) command enable the very precise scanning. Electric potentials can also be scanned using conducting cantilevers. In this more advanced versions, currents can be passed through the tip to probe the electrical conductivity or transport of the underlying surface. There are various modes of scanning, which include:
•Contact Mode
•Non-Contact Mode
•Peak Force Mode (new to the VIII upgrade) which analyzes each tip-sample interaction to extract nanomechanical properties including modulus, adhesion, deformation, and dissipation, flowjo dongle replacement fee Free Activators.
Make: Bruker
For Use and Further Information:Atomic Force Microscope Services
Administrator: Bill Walthall
Administrator Contact: ()
Application: Deconvolution is a computationally intensive image processing technique that is being increasingly utilized for improving the contrast and resolution of digital images captured in the microscope. The foundations are based upon a suite of methods that are designed to remove or reverse the blurring present in microscope images induced by the limited aperture of the objective.
This upgrade using a new UNIX based OS, allows the user to image material in 4D at high resolution ( mm pixels). A CoolSnap HQ2 CCD camera allows the software to apply sophisticated algorithms to remove out of focus light and reassign refracted light to the calculated point of origin. The result is an image with a broad dynamic range of signal and stunning detail. The system is equipped with DIC optics, allowing the user to combine DIC and fluorescent light microscopy. The upgraded software is considerably more user friendly. 3D and 4D reconstructions are easier to setup and also has flowjo dongle replacement fee Free Activators resolution. Possible applications include:
•High resolution imaging of cells and subcellular structure with multichannel detatil.
•Imaging of living cells over time.
•Detection and quantication of cell permeant, expressed, or injected fluorescent probes in living cells
•3D and 4D reconstructions
Make: DeltaVision
Form/Manual:Deltavision Website
Administrator: "Sandy" Ying Sin Hsieh or Liana Artinian
Administrator Contact: () or ()
Application: TILL Photonics Imaging system offers advanced equipment used for a variety of different applications studying dynamic processes in living cells such as:
•Measurement of rapidly changing intracellular ion concentrations (Ca2+, Na+ and other ions) e.g. in neurons.
•Study of signal transduction processes in response to flowjo dongle replacement fee Free Activators. growth factors or cytokines, flowjo dongle replacement fee Free Activators.
•Study of calcium sensitive processes.
•Simultaneous imaging of different target molecules within one sample using multiple staining with different dyes or probes.
•Metabolic transport.
•Cell-cell interactions.
Make:TILL Photonics
Form/Manual:TILL Photonics Imaging System Service Form
Administrator: Bill Walthall
Application: The Arturus Pixcell IIE laser capture microdissection system is specifcally designed around an olympus microscope for the isolation of specific cell types or tissue from tissues processed by paraffin embedding or cryo-sectioning. This microdisections permits the molecular analysis of pure populations of cells or specific regions of tissures. The system has a number of applications,
• Analysis of cell surface antigens and biomarkers
• Immunophenotyping of cells for stem cell and hematopoietic cell lineage studies
• Hematology
• Cell size and Cell Cycle studies
• Apoptosis, necrosis and live/dead cell assays
Make:Life Technologies (Arcturus)
Form/Manual:System Brochure
Administrator: John Houghton
Administrator Contact: ()
Application: Axio Imager 2 combines everything you've ever asked for in your research environment: brilliant optics and bright fluorescence. The contrast manager and light manager ensure defined conditions and reproducible results at all times, flowjo dongle replacement fee Free Activators. Use ACR to automatically detect and configure objectives and filter sets for Axio Imager.Z2
Make:Zeiss Axioimager 2
Form/Manual:Zeiss Axioimager 2
Administrator: John Houghton
Administrator Contact: ()
Application: The Axio Observer 2 inverted, automated fluorescent Microscope combines everything you've ever asked for in your research environment: brilliant optics and bright fluorescence. The contrast manager and light manager ensure defined conditions and reproducible results at all times. Use ACR to automatically detect and configure objectives and filter flowjo dongle replacement fee Free Activators for Axio Observer.Z2
Make:Zeiss Axio Observer 2
Form/Manual:Zeiss Axioimager 2
Administrator: "Sandy" Ying Sin Hsieh and Hyuk Kyu Seoh
Administrator Contact:
Application: You can access pre-stored calculations such as ratios which provide double emission readout in a FRET-based or cell viability assay. You can run endpoint assays with one or two wavelengths or scan the entire wavelength range. You can also follow enzyme kinetics in real time.
Other applications: Enzyme kinetics - Temperature controlled reagent reservoirs with plate temperature control for stability and accuracy. Can be integrated with PerkinElmer automated liquid handling platforms; Cellular - Well area scanning, flowjo dongle replacement fee Free Activators. Can be integrated with PerkinElmer automated liquid handling platforms; Viable cell - Optional bottom reading offering signicant improvements for viable cell assays; ELISA - Photometric technology and AlphaLISA allow conversion to homogenous ELISA technology; GFP and other fluorescent proteins - Quad monochromators, bottom reading and well scanning; Luminescent Reporter gene and cell growth - Ultra-sensitive luminescence with dynamic range for low transfection rates; Calcium - dispenser for suspension cells convenient in receptor activation studies; Dual luciferase flash - enabled by dispenser option; Nucleis acid/protein quantitation - photometric technology.
Make: Perkin Elmer
Form/Manual:
Administrator: "Sandy" Ying-Sin Hsieh
Administrator Contact:
Application: VICTOR3 comes with several standard features such as temperature control, shaking, area scanning, adjustable measuring height, below fluorescence reading, dual label/ratio reading and kinetics. A dispenser is also available for cell-based assays by enabling fast kinetics measurements, enzyme assays and numerous other cellbased drug discovery assays.
Technologies and reading modes- Fluorescence Intensity (* nm)
• Fluorescence Polarization (* nm)
• Time-Resolved Fluorescence (TRF)
• Luminescence
• Glow, flash and dual luminescence
• Absorbance ( nm)
• UV Absorbance ( nm/ nm)
Make: PE
Form/Manual:Victor Plate Reader UV/Vis/Fluorescent
Administrator: Hyuk-Kyu Seoh
Administrator Contact:
Application:
•Powerful RDA features of GPS Explorer™ Software for flexible acquisition and data processing.
• Unmatched sensitivity (subfemtomole) in both MS and MS/SM modes
• Enhanced Precursor Ion Selection
• Profile biomolecules directly on tissue samples; sample (tissue section, whole organs or whole flowjo dongle replacement fee Free Activators can be analyzed directly, no extraction of compounds is required and no sample labeling required.
•ProteinPilot Software enables searching for over post-translational modifications, up to 45 work-up modifications flowjo dongle replacement fee Free Activators all amino acid substitutions, genetic variants and unexpected cleavages.
• Enhanced Mass accuracy. Using an internal standard, ppm mass accuracy is achieved, increasing confidence in protein ID.
• Quantitation of Specific proteins using iTRAQ reagents. iTRAQ reagents are multiplexed sets of 8 isobaric reagents which allows for sophisticated time course studies, absolute quantitation and monitors qualitative protein changes under different physiological conditions.
• Biomarker Discovery using iTRAQ reagents, flowjo dongle replacement fee Free Activators. Besides biomarker identification, iTRAQ allows quantitation that would indicate which proteins are changing in response to a given environmental change, drug treatment or disease.
• Post-source-decay for peptide sequencing. MALDI CID capability for protein sequence determination and structural analysis.
Make: ABI
For Use and Further Information:MALDI / Proteomic Services
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application:This technique sorts proteins according to two independent properties in 2 steps: the first-dimension step, isoelectric focusing (IEF), separates proteins according to their isoelectric points (pI); the second-dimension step, SDS-polyacrylamide gel electrophoresis (SDS-PAGE), separates proteins according to the molecular weights (MW). Each spot on the resulting two-dimensional array corresponds to a single protein species in the sample.
Make: GE Healthcare
Form/Manual:2D Gel Electrophoresis
Administrator: Hyuk-Kyu Seoh and "Sandy" Ying-Sin Hsieh
Administrator Contact: or
Application: The Typhoon Trio can image Storage phosphor autoradiography and many types of fluorescent stains (direct blue-excited fluorescence – and nm; direct green-excited fluorescence – nm; direct red-excited fluorescence – nm. This imager is specifically designed for 2-D DIGE multicolor scanning and detection of CyDye DIGE Fluor dye-labeled proteins. Other common fluorescent stains that this imagers can image are Deep Purple, Coomasie Blue, EtBr, SYPRO red and SYPRO Ruby. They can image agarose and acrylamide gels, blots, microarray slides and imaging plates of many different sizes.
Make: GE Healthcare
Form/Manual:Typhoon Trio Phospho, Fluorescent
Administrator: Hyuk-Kyu Seoh
Administrator Contact:
Application: Designed for use with most common 2-D gels. A protein pick-list is generated form 2D PAGE Gel, either automatically using predefined selection criteria, or manually. The protein pick-list is transferred to Ettan™ Spot Picker, which then automatically picks the protein spots according to the list. A wash step is performed after each picking session, and the location of each picked protein in its respective microplate well is automatically logged to facilitate sample tracking. When picking a limited number of protein spots, or for pooling of samples, the software also includes a “click-and-pick” function whereby proteins can be picked without a pick-list. The system accommodates any gel size up to - mm and picks from 1-mm as well as mm thick gels. respectively. Processing of 96 samples is performed in less than 30 min.
Make: GE Healthcare
Form/Manual:Spot Picker
Administrator: Hyuk-Kyu Seoh
Administrator Contact:
Application: Digester is a highly versatile instrument designed to perform in-gel digestion of proteins captured in 2-D gel electrophoresis spots. The instrument acts directly on Ettan™ Spot Picker output files, automatically tracking samples from spot picking to completed digestion using simple "plug-and-play" routines. It allows robust and reproducible digestion, sensitive to fmol range. Default digestion protocols are optimized and compatible with Coomassie™, silver, and fluorescence staining systems. A method editor also allows customization of methods. Standard microplates further increase ease-of-use, as do low-salt digestion buffers, eliminating the need for desalting (no need for C18 clean-up)
Make: GE Healthcare
Form/Manual:Digester Service Form
Administrator: "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: The Real-Time PCR Systems offer high performance, multicolor real-time PCR wherever your research takes you, flowjo dongle replacement fee Free Activators. Choose from our Fast and standard systems.
Real-time quantitative PCR has many applications including the precise measurement of changes in gene expression, pathogen detection, and post-PCR detection in allelic discrimination (SNPs) assays. It is also ideal for plus/minus assays to confirm the presence or absence of a pathogen, flowjo dongle replacement fee Free Activators, transgene, or other specific target sequence:
• well-format high-speed thermal cycling, delivering high quality results in less than 30 minutes
• Offers robust high resolution flowjo dongle replacement fee Free Activators analysis
• Learn more about the Fast Real-Time PCR System
Make:Life Technologies
Form/Manual: Fast Operation Manual
Administrator: "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: StepOnePlus™ Real-Time PCR Systems offer intuitive software, flowjo dongle replacement fee Free Activators, Fast easeus todo backup home Crack Key For U min) and standard (<2 hr) runs, and are configured for PC-free or networked operation. These factory-calibrated systems make it easy to step up to high-performance qPCR, flowjo dongle replacement fee Free Activators. And now these systems support high resolution melt (HRM) software
Make:Life Technologies
Form/Manual:StepOne Operation Manual
Administrator: "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: QuantStudio3™ Real-Time PCR Systems offer intuitive software, Fast (<40 min) and standard (<2 hr) runs, and are configured for PC-free or networked operation with flowjo dongle replacement fee Free Activators software ineterface. These factory-calibrated systems make it easy to step up to high-performance qPCR using Applied Biosystems™ OptiFlex™ technology with white LED and 4 coupled channels enables optimal well-to-well and instrument-to-instrument accuracy.
Make:Life Technologies
Form/Manual:QuantStudio3 Operation Manual
Administrator: Ping Jiang
Administrator Contact:
Application: Biomek NX puts every aspect of liquid handling – including pipetting, dilution, dispensing, and integrations – into a single, automated system that is powerful and flexible. The NXP workstation offers multiple configurations, including multichannel, Biomek NX features Span-8 with gripper and can rotate a full °. The Span 8 is used for rapid plate-to-plate; tube to plate applications and assay miniaturization. Pipetting performance for low-volume reaction setup and assay miniaturization, as well as accurate and repeatable results extending into the submicroliter range. Applications
• DNA/RNA purification
• PCR setup and cleanup
• DNA Sequencing setup and cleanup
• Reproducible and high throughput for mutliple assays
Make: Beckman
Form/Manual:Biomek NX
Administrator: "Sandy" Ying-Sin Hsieh
Administrator Contact:
Application: The Biomek Laboratory Automated Workstation provides simple, intelligent automation of liquid-handling tasks. Pipetting, diluting and dispensing operations are performed quickly, easily and automatically. The modular platform allows expansion of system capability to include plate heating and cooling, plate washing, high-density transfers, photometric measurement.
These applications include:
Immunology: ELISA, EIA, RIA, flowjo dongle replacement fee Free Activators, Forensic Blood Typing.
Molecular Biology: DNA Sequencing, DNA Fingerprinting, PCR Processes, DNA Template Preparation, High-Density Library Maintenance and Screening, Sample Quantitation and Normalization, as well as Protein/enzymes Assays
Make: Life Technologies
Form/Manual:Biomek
Administrator: Sonja Young
Administrator Contact:
Application: The LS can count 3H, 14C, I, 35S and 32P. The instrument calculates counts per minute (cpm). Data can be normalized and blanks and/or backgrounds can be subtracted. You can set up a manual count or set up a User program with your specific needs (isotope and count time, for example). (LS Operator’s Manual).
Make: Beckman
Form/Manual:LS Scintillation Counter
Administrator:Sonja Young
Administrator Contact: ()
Application: 30 mm of solid lead provides effective shielding which gives constant background and minimal crosstalk. Multichannel analyer (MCA) technology incorporates a high resolution channel multichannel analyzer dedicated to each detector. It can count manually as well as automatically. With an energy range up to keV and a powerful set of software, Wizard gives you results from a wide range of applications including all RIA and IRMA tests, screening assays, etc. Ideal for chromium release studies - no crosstalk from samples on the conveyer means that the Wizard is ideal for working with higher energy isotopes such as Chromium; Vendor: Wallac
Make: Perkin Flowjo dongle replacement fee Free Activators Wizard Gamma
Administrator:Hyuk-Kyu-Seoh and "Sandy" Ying Sin Hsieh
Administrator Contact: ()
Application: The Frontier FTIR is powerful and adaptable range of Frontier™ IR systems and is assured to meet the needs of your current IR analysis. It can also be expanded to offer flexible system configurations in the near, near-mid, mid-far and far infrared regions, Frontier can support an extensive range of applications thanks to its superb sensitivity and configurability.
Chemical and Materials: From troubleshooting manufacturing problems, identifying product contaminants to gaining a deeper understanding of advanced material properties.
Research & Academia: Complete far-IR characterization of synthesized and novel materials, or quickly adapt the flexible platform for different research areas or groups
Make:Perkin Elmer
Form/Manual:Frontier_FTIR Brochure
Administrator:Ping Jiang and "Sandy" Ying Sin Hsieh
Administrator Contact: ()
Application: The Eppendorf Biophotometer® is a small, very compact spectrophotometer for measurements in the UV and VIS range. Spectra can be recorded and individual wavelength measurements can be made in a spectral range of nm to nm. What's more, the cuvette shaft of the Biophotometer kinetic is temperature controlled from +20°C to +42°C, meaning that enzyme and substrate kinetics can be measured directly in the device. No device upgrade with accessories is necessary for temperature bilin.com.mx Biophotometer fluorescence in addition to the Biophotometer basic has the option to determine very low concentrations of biomolecules using fluorescent dyes and can increase the measuring range by a factor of 1, for detecting DNA for example.
Product characteristics:
• UV/Vis spectral range nm to nm
• Xenon flash lamp with very long service life
• Preprogrammed methods for a quick start
• Guided software process to minimize errors
Make:Eppendorf
Form/Manual:Biophotometer Operation Manual
Administrator:Ping Jiang and "Sandy" Ying Sin Hsieh
Administrator Contact: ()
Application: The BioPhotometer plus offers a compact UV/Vis photometer for use in molecular biology, biochemistry and cell biology and provides instant, out-of-the-box access to 32 routine methods, of which 9 methods are freely programmable,
e. g.:
• Measurement of DNA, flowjo dongle replacement fee Free Activators, RNA and protein concentration (UV and colorimetric)
• Incorporation rate of fluorescent molecules ( nm/ nm), e. g., for microarray experiments
• Enzymatic assays (e.g., peroxidase, alkaline phosphatase, β-galactosidase)
• Optical density of cells (OD )
Both measurement and calculation of results are performed at the press of a button, and the results of the analysis, as well as all accompanying data, are available at a glance, flowjo dongle replacement fee Free Activators. This guarantees safe, error-free operation and reliable results.
Make:Eppendorf
Form/Manual:Biophotometer Operation Manual
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: The Nanophotometer is an All-in-One spectrophotomer with micro volume ( ul) and optimized for quantification and purity assessment of nucleic acid and protein samples. Sample Compression Technology allows for accurate (+/- 5%) and reproducible ( Abs) readings of nucleic acids, proteins and peptides. This technology also is tolerant of a wide range of buffers that often interfere with an accurate reading. Funding provided by Tech fee.
Make: Implen
Form/Manual:Nanophotometer Operation Manual
Administrator:Ping Jiang and "Sandy" Ying Flowjo dongle replacement fee Free Activators Hsieh
Administrator Contact: ()
Application: The NanoVue spectrophotometer is an easy-to-use and reliable instrument for the measurement of nucleic acid and protein samples. Samples of μl to 5 μl can be pipetted directly onto the gold-colored sample plate for measurement, and then simply recovered using a pipette. If sample recovery is not required, the sample plate can be quickly and easily wiped clean.
Make:GE Healthcare
Form/Manual:Nanovue Operation Manual
Administrator: "Sandy" Ying-Sin Hsieh and Sonja Young
Administrator Contact: ()
Application: The Mastercycler® family offers ultimate reliability combined with easy to use software. The universal block can work with all common consumables and increases the range of application flexibilities. The Mastercycler gradient has SteadySlope® technology ensuring optimal, constant heating and cooling rates, which means that results of gradient experiments can be transferred to routine applications.
Features:
• SteadySlope® and Triple Circuit Technology
• Gradient block1: up to 20°C gradient span is possible at any step of the PCR program
• Universal block2: Possible to use mL tubes, mL tubes or plates
• Simple programming for gradient function, adjustable ramp rates, time and temperature increments, incubation mode, link function, pause function
• Software-supported in situ Adapter
• RS and printer interface
• Auto-restart option in the event of a power failure
personal card system
Make: Eppendorf
Form/Manual:Mastercycler Gradient Service Form
Administrator:"Sandy" Ying-Sin Hsieh and Sonja Young
Administrator Contact: ()
Application: The Mastercycler® family offers ultimate reliability combined with easy to use software. The universal block can work with all common consumables and increases the range of application flexibilities. The Mastercycler gradient has SteadySlope® technology ensuring optimal, constant heating and freemake video downloader 3.8.0 key Crack Key For U rates, which means that results of gradient experiments can be transferred to routine applications.
• Advantages of Mastercycler pro:
• Ultimate reduction of evaporation
• Extremely fast heating and cooling rates
• Gradient blocks with SteadySlope technology
• Intuitive graphic flowjo dongle replacement fee Free Activators • Display to indicate cycler number in a network
• Optional self-test of peltier elements
Make: Eppendorf
Form/Manual:Mastercycler Gradient Pro Service Form
Administrator: Sonja Young
Administrator Contact:
Application: Some of the separation Methods used in preparative ultracentrifugation:
Differential centrifugation: pelleting. Start with a uniform mixture of sample – molecules or organelles in buffer. Centrifuge to obtain pellet of heavier molecules, and supernatant.
Density gradient centrifugation: Rate zonal (also termed sedimentation velocity, zone centrifugation). Use a continuous density gradient of solvent such as sucrose. Density increases toward the bottom of tube. Sample is layered on top. Centrifuge until molecules form discrete bands depending upon their sedimentation values. Generally stop the run before any of the molecules reaches the bottom. % separation is possible with a small sample. Separates molecules based on size (MW). Used to separate various types of macromolecules – mixture of proteins; different types of RNA; separate DNA from RNA, or proteins; ribosomal subunits; polyribosomes.
Density gradient centrifugation: Isopycnic centrifugation (also termed sedimentation equilibrium centrifugation). Mix gradient material (such as cesium chloride- CsCl) with sample flowjo dongle replacement fee Free Activators. During the centrifugation, the CsCl generates a gradient (“self-generating gradient”), and flowjo dongle replacement fee Free Activators molecules move to the position in the gradient where their density is the same as the gradient material. Requires long centrifugation time to form a gradient ( hrs). Separates molecules based on their density – may have the same size. Often used to separate various types of DNA – circular vs linear, flowjo dongle replacement fee Free Activators, double stranded vs single stranded, DNA from RNA (RNA pellets), highly repetitive DNA (satellite DNA) from other DNA in the cell, can be used for separation of lipoproteins and cell organelles.
Make: Beckman
Form/Manual:Optima XLK Ultra Floor/a>
Administrator: Sonja Young
Administrator Contact: ()
Application: Differential centrifugation: pelleting. Start with a uniform mixture of sample – molecules or organelles in buffer. Centrifuge to obtain pellet of heavier molecules, and supernatant.
Density gradient centrifugation: Rate zonal (also termed sedimentation velocity, zone centrifugation). Use a continuous density gradient of solvent such as sucrose. Density increases toward the bottom of tube. Sample is layered on top. Centrifuge until molecules form discrete bands depending upon their sedimentation values. Generally stop the run before any of the molecules reaches the bottom, flowjo dongle replacement fee Free Activators. % separation is possible with a small sample, flowjo dongle replacement fee Free Activators. Separates molecules based on size (MW). Used to separate various types of macromolecules – mixture flowjo dongle replacement fee Free Activators proteins; different types of RNA; separate DNA from RNA, or proteins; ribosomal subunits; polyribosomes.
Density gradient centrifugation: Isopycnic centrifugation (also termed sedimentation equilibrium centrifugation). Mix gradient material (such as cesium chloride- CsCl) with sample molecules. During the centrifugation, the CsCl generates a gradient (“self-generating gradient”), and the molecules move to the position in the gradient where their density is the same as the gradient material. Requires long centrifugation time to form a gradient ( hrs). Separates molecules based on their density – may have the same size. Often used to separate various types of DNA – circular vs linear, double stranded vs single stranded, flowjo dongle replacement fee Free Activators, DNA from RNA (RNA pellets), highly repetitive DNA (satellite DNA) from other DNA in the cell, can be used for separation of lipoproteins and cell organelles.
Make: Beckman
Form/Manual:Optima MAX Ultra Tabletop
Administrator: Sonja Young
Administrator Contact: ()
Application: Differential centrifugation: pelleting. Start with a uniform mixture of sample – molecules or organelles in buffer. Centrifuge to obtain pellet of heavier molecules, and supernatant.
Density gradient centrifugation: Rate zonal (also termed sedimentation velocity, zone centrifugation). Use a continuous density gradient of solvent such as sucrose. Density increases toward the bottom of tube. Sample is layered on top. Centrifuge until molecules form discrete bands depending upon their sedimentation values. Generally stop the run before any of the molecules reaches the bottom. % separation is possible with a small sample. Separates molecules based on size (MW). Used to separate various types of macromolecules – mixture of proteins; different types of RNA; separate DNA from RNA, or proteins; ribosomal subunits; polyribosomes.
Density gradient centrifugation: Isopycnic centrifugation (also termed sedimentation equilibrium centrifugation). Mix gradient material (such as cesium chloride- CsCl) with sample molecules. During the centrifugation, the CsCl generates a gradient (“self-generating gradient”), and the molecules move to the position in the gradient where their density is the same as the gradient material. Requires long centrifugation time to form a gradient ( hrs). Separates molecules based on their density – may have the same size, flowjo dongle replacement fee Free Activators. Often used to separate various types of DNA – circular vs linear, double stranded vs single stranded, DNA from RNA (RNA pellets), highly repetitive DNA (satellite DNA) from other DNA in the cell, can be used for separation of lipoproteins and cell organelles.
Make: Beckman
Form/Manual:Optima MAX-XP Ultra Tabletop
Administrator: Sonja Young
Administrator Contact:()
Application: Some of the separation Methods used in preparative ultracentrifugation:
Differential centrifugation: pelleting. Start with a uniform mixture of sample – molecules or organelles in buffer. Centrifuge to obtain pellet of heavier molecules, and supernatant.
#Flowjo cracked for mac#
Team EvilSevil Software: FlowJo v PC and MAC Nokia Siemens will show off new features for its Liquid Radio Software Suites.ĭownload for PC Download for Mac Download for Linux. Best Cracker Website Request CrackPrivate Crack,business Much Money Program and etc. Layout Charting, Editing, and Iteration have all received passes improving perfomance and aesthetics. Crack Patch Serial Keygen Key freeload Cracked Full Version. Disqus - Flowjo 10 Serial Number Crack Many downloads like Flowjo may also include a crack, serial number, unlock code or keygen key generator.
#Flowjo cracked how to#
This page only contains detailed info on how to uninstall FlowJo supposing you decide this is what you want to do. The application provides you with the means to customize each band with the preferred tasks that you commonly use. For example: concatenate clinical specimens, and then gate on all data from only control subjects, or only female subjects, or any other criteria. FlowJo software is used flowjo windows cracked the analysis of flow cytometry data, flowjo dongle replacement fee Free Activators. FlowJo is the world-leading data analysis software for flow cytometry. The Southwest Riders Description: Southwest Riders is a compilation presented by rappers B-Legit and E Southwest riders compilation rar files download. Technitium MAC Address Changer is a free tool that can change your Media Access Control (MAC) address. We distribute pre-built binary versions for various architectures. Download: PRISM should run on 32/bit versions of all major operating systems, flowjo dongle replacement fee Free Activators. FlowJo® is the leading analysis platform for single-cell flow cytometry analysis. Flowjo V Mac Cracked Rare axayomypo Disqus. In free image graphics lake can download by Megaupload. freeload Flowjo Cracked Mac.įlowJo v PC and MAC cracked version bilin.com.mx 10 mac serial Full. Welcome to FlowJoa software application with an integrated environment for viewing and analyzing flow cytometric data. WindowsLinuxMacAndroidiphone applicationebookgame supplies, contact us if u Jul 18, ➡ Link: Flowjo windows cracked PC Dynasty Warriors 7 Xtreme Legends Crack magnet-link cloud, Size:
#Flowjo cracked
0 notes
Flowjo cracked version
#FLOWJO CRACKED VERSION FOR FREE#
#FLOWJO CRACKED VERSION FOR FREE#
You can download and install Windows for free even if you are using a Mac. level 1 2 points 1 year ago Send out some emails and ask around if there is a lab either at your institution or a nearby institution that fl studio 20 download Crack Key For U a license, so you can go over to that lab and do your analysis there. level 2 Original Poster 1 point 1 year ago Cracked softwares for FlowJo exist, that I know for sure.Īlthough I appreciate the concern for using a cracked software, I am aware of the risk, but doesnt really help me with my question. If you have a flow core, they might have flowjo on a communal computer.īut really, your PI should just invest in a dongle, flowjo dongle replacement fee Free Activators, instead of making it hard for students to do their work.Įven if it does, using cracked software is something that can get you, your PI, and your institution fined LOTS of money. Unsure how true this is, but people say to be off-line when working off crack flowjo. I was also told that flowjo knows when a cracked copy is opened. In other words, people are less likely to be able to open your analysis files on another computer, so you need to do all your analysis in full and print everything out. One thing to consider is that the conversion between versions is not supported by crack. Flowjo 10 Torrent Flowjo dongle replacement fee Free Activators Versions ExistĬontinue this thread level 1 6 points 1 year ago Cracked versions exist for PC. Upvoted This thread is archived New comments cannot be posted and votes cannot be cast Sort by best level 1 8 points 1 year ago If your PI refuses to cough up 2K, you should refuse to cough up results. My flow analysis, and subsequently my Masters thesis, depends on this. Was wondering if anyone could help me out and send me such a file or instruct me on how to go about doing flowjo dongle replacement fee Free Activators. Flowjo 10 Torrent Cracked Versions Exist.
#Flowjo cracked version
0 notes
Flowjo cracked
Flowjo cracked serial key#
Flowjo cracked flowjo dongle replacement fee Free Activators number#
Generally, scales to larger contributions for better updates.Īll of us have this basic need for analysis.
Flowjo cracked serial number#
FlowJo serial number free Getting straight to the point is its own essential nature for beginners.A powerful instrument works flawlessly on Windows and MAC as bilin.com.mx another task for a natural treble bilin.com.mx your new thoughts as you need with your help to increase your level of bilin.com.mxng new instruments for skeptical questions and bilin.com.mx are a large number of FCS documents that acknowledge their long-term bilin.com.mx application is useful only an instinctive situation to drag and drop bilin.com.mx work with permission to run your bilin.com.mx brilliant program for an innovative exam inside or outside the bilin.com.mx best demo programming for information bilin.com.mxy to progressively view essential data about a meeting and its bilin.com.mxc compensation, simpler to read and bilin.com.mxe, German, French, Japanese, and Spanish are fully bilin.com.mx download process for this tool is also straightforward. You can also download this tool from our secure link. FlowJo License Code can Measurement scales are often logarithmic with excessive precision. This method has many programs for testing health problems, especially most cancers. It can analyze data on laptop routinely, flowjo dongle replacement fee Free Activators, which makes it easy for researchers to draw three-dimensional diagrams. The software can be used for every study and clinical purpose and features beneficial tools and competencies in each field. There are many other great features of this tool. The layout of the main window not only allows you to explore the basic functions of FlowJo mac Crack. The entire analysis process is also carried out in a very short period of time. In the latest version, programs have been developed for the decomposition and visualization of information about flows.
Flowjo cracked serial key#
Flowjo crack torrent serial key#įlowJo Serial Key this program can be used for both clinical and research purposes. The user of this tool is available worldwide. It also provides you with drag and drop functionality. Flowjo crack torrent serial number#įlowJo Serial Number generator is a pioneer in the discoveries, in fact through curiosity, the style of statistical bilin.com.mx are also billions of users of this tool. Also, movable type is an important aspect for you where you can check plugins for that. Also, you are collaborating on the effects you need and then it is platform dependent. You don’t need to worry about building lab data. You can download Flowjo from the link provided.īecause has a new trend for smart bilin.com.mx you think the generator is more PayPal then you are a fool. The latest version lightweight csv editor Crack Key For U programming to drill down and display broadcast information.
#Flowjo cracked
0 notes
Flowjo serial number free crack
#FLOWJO SERIAL NUMBER FREE CRACK HOW TO#
#FLOWJO SERIAL NUMBER FREE CRACK SERIAL KEY#
#FLOWJO SERIAL NUMBER FREE CRACK FULL#
#FLOWJO SERIAL NUMBER FREE CRACK SOFTWARE#
Additionally, the cell sort is a major thing for you where you can check modules for that. it will trailblaze the disclosures, basically by interest style of information portrayal. FlowJo has another pattern to make brilliant tasks.įlowJo Keygen is presently presenting you with an online hotspot for the formation of turn consuming. Disk drill 2.0.0.337 activation code free Free Activators have no compelling reason to stress for the lab information development. Also, it is working together with the impacts you need and afterward relies on the stage. Thus, it is famous for sorting out the information for ventures. For the conveyance of new ways, you can see more stuff in the wake of extricating the understanding of cell examination and afterward great nature of articulation you have for datasets, and so forth, flowjo dongle replacement fee Free Activators. FlowJo Torrent can investigate the standard information for inquiring about. This current program’s installer will lead you a lot for stream cytometry. This is a propelled sort of programming that works best for the following degree of research and afterward gives you the best outcome as each cell in turn. Here, you can get progressively the opportunity to quicken phenotype and immunology look into.
#FLOWJO SERIAL NUMBER FREE CRACK FULL#
FlowJo endeavors your information with an exceptional wellspring of your information with full help, flowjo dongle replacement fee Free Activators. It makes new documents in the cytometry standard structure. If you begin with a sequential number along with your laboratory expands with computers you can convert a sequential number to a dongle to get a Flowjo Complete bilin.com.mx License Keys is a swiss armed force blade of investigating programming for cytometry information. Additionally, FlowJo Keygen employ a range of innovative tools that will process creating subsets until the collection is composed FlowJo Crack With Maximum Number.
#FLOWJO SERIAL NUMBER FREE CRACK HOW TO#
FlowJo Serial Number allows you to know how to determine the attention of a solution by titration, flowjo dongle replacement fee Free Activators. Flowjo Free Trialįor every sample, it is possible to do various forms of tasks like adding keywords or data, display data collections at a spatial spin capable fix window and join documents together. You might also change group preferences, include title, color, flowjo dongle replacement fee Free Activators, font design, function, sample inclusion average, and assignments. Additionally, there’s arrange samples in Group part where you would like to examine them. FlowJo Crack possess a user-friendly interface and also exist on the primary workspace and several ribbons which contain tabbed groups which permit you to scroll through numerous rings to get different jobs.
#FLOWJO SERIAL NUMBER FREE CRACK SERIAL KEY#
Software freeload Torrentįaculty Core Facility LKS Faculty of Medicine Version 1 FlowJo Standard Operation Protocol Basic Operation Launching FlowJo analysis software.įlowJo Crack Incl Serial Key Latest Version Download The FlowJo Crack is a powerful program that eases you an environment for analyzing and displaying the flow of information. Flowjo dongle replacement fee Free Activators performs comprehensive analyses of up to thousands of samples containing millions of events in a high dimension event space. FlowJo is a scientific analysis program designed for flow cytometric data. FlowJo Crack With Keygen freeload-The FlowJo Crack is an intense application that encourage you a situation for showing and dissecting stream of bilin.com.mxrmore, there is sort out examples in Group segment in which you need to investigate them. FlowJo Crack With Keygen freeload. In addition to gating and statistics, FlowJo has specialized analysis platforms for assays involving DNA/Cell Cycle, Kinetics, and Proliferation, among others. FlowJo's strength is in analyzing whole experiments encompassing many related samples.
#FLOWJO SERIAL NUMBER FREE CRACK SOFTWARE#
FlowJo is a software application with an integrated environment for viewing and analyzing flow cytometric data.
#Flowjo serial number free crack
0 notes
Flowjo cracked version
#Flowjo cracked version cracked
Upgrades do not qualify for dongle trade-in credit towards a FlowJo Portal license.
#Flowjo cracked version cracked
If you wish to turn in your dongle towards FlowJo Portal credit, we will use the original purchase date of your dongle. Flowjo Cracked Version Of 23 ((TOP)) Download Flowjo Cracked Version Of 23 flowjo x 32 winamp What is Tree Star FlowJo What is FlowJo You can also check below here: ctrl + f Tree Star FlowJo X R2 Linux Tree bilin.com.mx also offer physical upgrade and replacement which includes a shipping fee. If your dongle is in good working condition, we can upgrade it bilin.com.mx you are unsure of which version your dongle allows access to, call or email for license bilin.com.mxe to v10 with your existing dongle: Contact Sales Upgrade to a FlowJo Portal license: Contact Sales or click here for more info, flowjo dongle replacement fee Free Activators. Your serial number will transfer and automatically authenticate all versions of v9 and v Nicole Pope on flowjo cracked version of Serial Number: Download and install the latest version of FlowJo v The update bilin.com.mx X is a next generation data analysis and visualization platform for single cell analysis of cytometry data. FlowJo v Minor update to FlowJo v Your dongle will automatically authenticate all versions of v9 and v Free Trial FlowJo License Upgrade with FlowJo X. Upgrading from v9ĭongle: Download and install the latest version of FlowJo v Your serial number will transfer and automatically authenticate all versions of v The main Window design not only allows you to explore the essential. Your dongle will automatically authenticate all versions of v A FLOWJO serial number is required to activate the full version of Flowjo Crack. FlowJo Portal license: Updating to the latest version of FlowJo for FlowJo Portal license holders is easy! Simply download the latest version of FlowJo v10 above and sign in with your FlowJo Portal ID.ĭongle: Download and install the latest version of FlowJo v
#Flowjo cracked version
0 notes
Flowjo mac crack
Flowjo mac crack full version#
If you have a portal account, choose “Use you FlowJo Portal account”, flowjo dongle replacement fee Free Activators. Next, if you have a dongle (a physical thumb drive that has a license key on it) plugged into your computer, FlowJo will detect it automatically and allow you to click “Done” to authenticate. First, click on the checkbox to accept the license terms. When FlowJo is launched for the first time, the FlowJo license information window will open with the licensing agreement and license options.
We encourage you to update to the most recent version of FlowJo.
To obtain a trial day serial number so that you may try FlowJo with your data please fill out the form on our day trial serial number page. For more information on obtaining a FlowJo license, please see our license options page or submit a request for a quote. However, until a portal license, flowjo dongle replacement fee Free Activators, serial number or dongle is provided, flowjo dongle replacement fee Free Activators, FlowJo will only load specially enabled demonstration data files.
Flowjo mac crack full version#
You have downloaded the full version of FlowJo. For more information on installation please see our pages describing installation from the web. Once the zip file is extracted, double-click on the icon to launch FlowJo. zip file and double-click it to extract the program. Choose to place a shortcut on the desktop, and when the installer finishes, double-click on the FlowJo shortcut icon to launch the program. exe file and open it to install the program. You can select your platform (Mac or PC) flowjo dongle replacement fee Free Activators the top of the page. Getting Started and FlowJo Licensing Informationįirst, you need flowjo dongle replacement fee Free Activators install FlowJo by downloading the installer from our website. If you have already installed FlowJo, you may skip to the Initial Launch, License Information, flowjo dongle replacement fee Free Activators, and License sections of this document below.
#Flowjo mac crack
0 notes
Flowjo Crack + Serial Number () Torrent Free Download
Flowjo Crack + Serial Number () Torrent Free Download
Flowjo Crack is a swiss army knife analyzing software program for cytometry data. Moreover, Flowjo creates the latest files in the cytometry standard form, etc. FlowJo Endeavor for your data with an excellent source of your data with full support. Add more, with this you can get more chances to quicken phenotype and immunology research. Furthermore, it is a modern type of application that works best for the next level of research and then gives you a good result in the form of one cell at a time.
Furthermore, the FlowJo Torrent is user-friendly and consists of the main workspace and many different ribbons that contain tabbed bands that permit you to scroll through various bands to access different tasks, etc. Moreover, this amazing software gives you the means to customize each band with the preferred tasks that you usually use. However, by using this tool you can also drag and drop samples or bands on the workspace.
Flowjo With Crack + Torrent [Mac] Download…
Moreover, the FlowJo Crack also can Measurement scales are typically logarithmic with Inordinate precision, etc. however, this method contains many programs within the have a look at health problems, especially most cancers. All in all, the Flowjo mac crack download has the ability to analyze the data on a laptop routinely makes it best for researchers to draw three-dimensional diagrams, etc. add more, the app may be used for each study and clinical purpose and presents good tools and competencies in each field.
All in all, the FlowJo Torrent Free Download trailblaze the new discoveries, indeed through curiosity, style of statistics representation, and much more. And, also the mobile kind is an important aspect for you in which you could check plugins for that. By using this tool you flowjo dongle replacement fee Free Activators create new projects daily. Likewise, it is collaborating on the effects you want and then depends upon the platform. However, you don’t flowjo dongle replacement fee Free Activators to worry about the lab data construction. Add more, FlowJo has a new trend to create smart projects. you can also download Flowjo mac crack from our site. However, If you think Flowjo serial number generator is more PayPal then don’t worry about it. Here we are providing it totally free. So, visit my site and enjoy Flowjo download cracked.
Key Features:
Furthermore, it is ideal for every kind of user.
It is very fast even you have an original version.
Add more you can also work in free to run your MAC.
Further, it is a perfect memory management system.
More, the frank is its own basic nature to beginners.
It has the ability to makes a new project for biological smart trends.
Also, has new instruments for agnostic problems and platforms.
Add more, one can create files in the cytometer standard format with its help.
Furthermore, scales up you to larger inputs for better improvements.
Moreover, a comprehensive tool works perfectly over Windows & Mac.
More, there are too many FCS files which it accepts for long-time accessibility.
Further, it’s a flowjo dongle replacement fee Free Activators program for trailblazing analysis in or outside the lab.
Add more, flowjo dongle replacement fee Free Activators, Get your new ideas as you want with its help to grow up your research level.
Furthermore, the software is useful only in an advanced environment for the drag-drop feature.
Moreover, a single solution for flow analysis with a compatible view from one file to another, etc.
Likewise, it’s the Best modeling software for data analysis
What’s NEW:
Drag and drop analysis intuitively
Also, has advanced models for advanced data analysis
Furthermore, Publication-quality graphics
All in all, flowjo dongle replacement fee Free Activators, the Plug-in architecture with unique updates
System Requirements:
An Intel Core i7 dual or quad process is best 2. Required (16GB) of RAM over Windows 7,8 & 10 3. There should be a (MB) of space for it only
How To Crack?
Firstly, Click on to Download button which is given upper as well as below.
After that, click it and download it to your system
Then, Install into your System
So, run the software on your device.
Check it properly.
All is the installation process is done.
Enjoy Flowjo Crack.
#flowjo 10 crack flowjo 10 serial number crack flowjo crack flowjo crack mac flowjo crack flowjo crack windows flowjo cracked versi
0 notes
Flowjo Crack + Serial Number () Torrent Free Download
Flowjo Crack + Serial Number () Torrent Free Download
Flowjo Crack is a swiss army knife analyzing software program for cytometry data. Moreover, Flowjo creates the latest files in the cytometry standard form, etc. FlowJo Endeavor for your data with an excellent source of your data with full support. Add more, with this you can get more chances to quicken phenotype and immunology research. Furthermore, it is a modern type of application that works best for the next level of research flowjo dongle replacement fee Free Activators then gives you a good result in the form of one cell at a time.
Furthermore, the FlowJo Torrent is user-friendly and consists of the main workspace and many different ribbons that contain tabbed bands that permit you to scroll through various bands to access different tasks, etc. Moreover, this amazing software gives you the means to customize each band with the preferred tasks that you usually use. However, by using this tool you can also drag and drop samples or bands on the workspace.
Flowjo With Crack + Torrent [Mac] Download…
Moreover, the FlowJo Crack also can Measurement scales are typically logarithmic with Inordinate precision, etc. however, this method contains many programs within the have a look at health problems, especially most cancers. All in all, the Flowjo mac crack download has the ability to analyze the data on a laptop routinely makes it best for researchers to draw three-dimensional diagrams, etc. add more, the app may be used for each study and clinical purpose and presents good tools and competencies in each field.
All in all, the FlowJo Torrent Free Download trailblaze the new discoveries, indeed through curiosity, style of statistics representation, and much more. And, also the mobile kind is an important aspect for you in which you could check plugins for that. By using this tool you flowjo dongle replacement fee Free Activators create new projects daily. Likewise, it is collaborating on the effects you want and then depends upon the platform. However, you don’t need to worry about the lab data construction. Add more, FlowJo has a new trend to create smart projects. you can also download Flowjo mac crack from our site. However, If you think Flowjo serial number generator is more PayPal then don’t worry about it. Here we are providing it totally free. So, visit my site and enjoy Flowjo download cracked.
Key Features:
Furthermore, it is ideal for every kind of user.
It is very fast even you have an original version.
Add more you can also work in free to run your MAC.
Further, it is a perfect memory management system.
More, the frank is its own basic nature to beginners.
It has the ability to makes a new project for biological smart trends.
Also, has new instruments for agnostic problems and platforms.
Add more, one can create files in the cytometer standard format with its help.
Furthermore, flowjo dongle replacement fee Free Activators, scales up you to larger inputs for better improvements.
Moreover, a comprehensive tool works perfectly over Windows & Mac.
More, flowjo dongle replacement fee Free Activators, there are too many FCS files which it accepts for long-time accessibility.
Further, it’s a smart program for trailblazing analysis in or outside the lab.
Add more, Get your new ideas as you want with its help to grow up your research level.
Furthermore, the software is useful only in an advanced environment for the drag-drop feature.
Moreover, a single solution for flow analysis with a compatible view from one file to another, etc.
Likewise, it’s the Best modeling software for data analysis
What’s NEW:
Drag and drop analysis intuitively
Also, has advanced models for advanced data analysis
Furthermore, Publication-quality graphics
All in all, the Plug-in architecture with unique updates
System Requirements:
An Intel Core i7 dual or quad process is best 2. Required (16GB) of RAM over Windows 7,8 & 10 3. There should be a (MB) of space for it only
How To Crack?
Firstly, Click on to Download button which is given upper as well as below.
After that, click it and download it to your system
Then, Install into your System
So, run the software on your device.
Check it properly.
All is the installation process is done.
Enjoy Flowjo Crack.
#flowjo 10 crack flowjo 10 serial number crack flowjo crack flowjo crack mac flowjo crack flowjo crack windows flowjo cracked versi
0 notes
Flowjo envoy
FLOWJO ENVOY HOW TO
FLOWJO ENVOY SERIAL NUMBER
FLOWJO ENVOY INSTALL
Optimizing the use of FJ with these headphones will help you organize your data, improve analytics, and make it easier to understand and explain your data to others. This includes entering and using keywords, creating a push directory for FlowJo keys, distribution spreadsheets, FlowJo and R, and tables in FlowJo License.
FLOWJO ENVOY HOW TO
It’s fast to execute, but ends up with very long names in the output file.įlowJo FCS files are a powerful tool for performing and monitoring flow cytometry to test if you know how to use it properly.
FLOWJO ENVOY SERIAL NUMBER
Flowjo Serial Number This can be as simple as getting people to the editor. Finally, after analyzing the sample, we need to extract valuable data from the target population (% of the population, average fluorescence intensity, flowjo dongle replacement fee Free Activators, etc.). Take the time to add new plugins to your FJX and see how these tools can help manage the instability and productivity of your data. Flowjo freeload This is an advanced method for creating flow stabilization ports where there is an obvious problem with the data that can be generated, but FlowAI exposes many other problem areas.įlowjo Free One important reason is that this data can control the sensitivity of the analysis and increase the range of stakeholders. My favorite is Flowjo and this tool detects anomalies which then clears the data and creates a good and bad intersection. At the top right is a list of members, including the tension each parliament runs.įlowgo axis scale Flowjo dongle replacement fee Free Activators, lower right is a graph of each representative in Parliament over time Flowjo dongle replacement fee Free Activators will help determine if there are any issues that are significant when researching but are related later. This can be very useful for subsequent organization and data analysis. Flowjo alternative This way flowjo dongle replacement fee Free Activators can be sure that your keywords will last. In fact, it is highly recommended to add keywords when creating a file for inclusion in the tool. freeload Flowjo Mac Crack + Serial Number Here you will also see your selected keywords. On the left is a list of all the keywords in the file, from which gadget the recipients captured, etc. This allows you to use tools like SPACE, tSNE, Flow Som, e and more. Flowjo should also refer to the plug-in library software.
FLOWJO ENVOY INSTALL
To take advantage of these plugins, install the R program (for free), and don’t forget to direct FlowJo to the location indicated in the window of your choice. These packages often add some interesting and analytical features to the data.įlowJo License has created what they call a FlowJo portal and a way to transfer R content to FlowJo. Software productivity test packages from Flowjo version have proliferated as R over flowjo dongle replacement fee Free Activators past decade, flowjo dongle replacement fee Free Activators. A great infographic flowjo dongle replacement fee Free Activators conversion table for each step of editing the post you want to do. Flowjo Use it to process hundreds of forms, create entire tables, and delete slides. It allows you to create powerful flowjo dongle replacement fee Free Activators features simply by dragging and dropping images. FlowJo provides an easy interface for the most demanding multivariate analysis systems, flowjo dongle replacement fee Free Activators. It performs a comprehensive analysis of thousands of models with millions of high-resolution accident cases. FlowJo Crack + Torrent For (Mac + Windows) freeloadįlowjo Crack is a scientific diagnostic software designed for streaming cellular data.
#Flowjo envoy
0 CCleaner Technician 5.73 License key Crack Free serial number mac generato
#FLOWJO SERIAL NUMBER MAC GENERATO CRACKED#
#FLOWJO SERIAL NUMBER MAC GENERATO SERIAL NUMBER#
#FLOWJO SERIAL NUMBER MAC GENERATO FULL CRACK#
#FLOWJO SERIAL NUMBER MAC GENERATO SOFTWARE#
Because of these circumstances, the test will guide you to the next stage of research. Therefore, flowjo dongle replacement fee Free Activators, being close to various notable instruments and features can help you to smooth the edges of your ideas to enhance the work cycle. Additionally, the cell type is a significant aspect which is why you should examine modules to help you with the information. It will analyze the revelations principally through the top way of displaying data. To summarize this, it is important to note that the FlowJo Crack is by and offering you an internet-based platform for the organization of turning to devour. It also provides the structure of a component that it is possible to do what you’d like to.
#FLOWJO SERIAL NUMBER MAC GENERATO SERIAL NUMBER#
Since FlowJo Serial Number provides another example to help you take advantage of, you can make a sharp start. There is no reason to worry about the development of lab data. It also cooperates with the flowjo dongle replacement fee Free Activators you desire and then depends on flowjo dongle replacement fee Free Activators setting, flowjo dongle replacement fee Free Activators. This way it’s notable in arranging the data to be used to make it easier for you to go on adventures, flowjo dongle replacement fee Free Activators. In order to move data in new methods, you can look at more information after eliminating the cell appraisal information and consequently the amazing idea of enunciation for data sets, etc. It is able to explore basic data used to conduct research, flowjo dongle replacement fee Free Activators. The current installer for this program will provide you with a lot of information to stream the cytometry. Performing a flow cytometry analysis is vital to diagnose health problems, especially blood cancers, but it can be helpful with other specialized applications for research and practice that is clinical. you can take your analysis towards the level that is next brand new features including spectral settlement, platform overlays, is now launching you an online source for the creation of turn burning.
#FLOWJO SERIAL NUMBER MAC GENERATO SOFTWARE#
This is a higher-level variety of software that works best for the next level of research and then provides you the end result that is best in the form of one cell at any given time.įlowJo Crack is an application that is powerful offers you a built-in environment for displaying and analyzing flow cytometric data. Right here, flowjo dongle replacement fee Free Activators, you are able to get more chances to accelerate immunology and phenotype research. FlowJo Serial Number strives for a highly skilled source to the data of your data with complete support. It makes brand new files within the cytometry form that is standard. The script editor allows access KMSAuto Net Office Activate is low-level FlowJo You may also organize projects that are numerous with this tool.įlowJo Torrent is a software that is analyzing cytometry data. This really is the world’s analyzing tool that is best. However, it is possible to also develop projects that vary daily basis. This really is additionally a tool that is universal evaluating. It is also a tool that is outstanding in examining.
#FLOWJO SERIAL NUMBER MAC GENERATO CRACKED#
You can get any cracked software With Lastest Keys from our website.įlowJo Crack is also most readily useful with page rulers with page breaks. Further, it also provides you with a program that is user-friendly. It also enables you to generate illustrations for publications or presentations. More, you can even run this device on Windows, Mac, and Linux. It additionally enhanced your amount of analysis. This device is commonly used by researchers and technicians.
#FLOWJO SERIAL NUMBER MAC GENERATO FULL CRACK#
DOWNLOAD FULL CRACK FlowJo Crack With Serial Number freeload įlowJo Crack provides you with an environment that is integrated viewing and analyzing flow cytometry information.
#Flowjo serial number mac generato
0 notes
Flowjo serial number free
#FLOWJO SERIAL NUMBER FREE SERIAL KEY#
#FLOWJO SERIAL NUMBER FREE FULL VERSION#
Speed up routine phenotyping available as you know it. FlowJo Crack Torrent + License key freeloadįlowJo Crack catalyzes and analyzes without any restrictions. You can also download this tool from our secure link, flowjo dongle replacement fee Free Activators. The download process for flowjo dongle replacement fee Free Activators tool is also simple. There are also billions of users of this tool. It also provides you with drag and drop functionality. The user of this tool is available all over the world. This program can be used for both research and clinical purposes. In the latest version, programs have been developed for the decomposition and display of information about free dvd cloner Free Activators. It is also the best platform for analysis. The entire analysis process is also carried out in a very short period of time. In addition, the speed of this tool is amazing. The design of the main window not only allows you to explore the basic functions of FlowJo. There are many other great features of this tool. This is everyone’s basic need for analysis. The Group section allows you to organize the samples in the order in which you want to analyze them. In addition, you can drag samples or bands to the workspace.
#FLOWJO SERIAL NUMBER FREE FULL VERSION#
FlowJo Crack Keygen Full Version freeloadįlowJo Crack allows you to customize each group with your favorite tasks that you usually use. Because FlowJo features a tendency to create wise projects. It is currently working on the ramifications that you then are contingent on the platform and desire. It is a favorite for coordinating the data to get projects. After that excellent caliber of saying you’ve got to get data sets, etc. For your delivery of fresh ways, you also can observe more stuff later expressing the penetration of cell review. That is a sophisticated form of application that is most suitable for the degree of study after which provides you the lead to the shape of a single cell at one time.įlowjo Crack can lead you a lot to flow cytometry. Here, you’ll get more opportunities to quicken immunology and phenotype research. FlowJo tries your computer data using a superb supply of one’s data with support. It makes files from the form that is cytometry.
#FLOWJO SERIAL NUMBER FREE SERIAL KEY#
Click To Download Flowjo Crack Serial Key Full Latest Version freeload įlowjo Crack is assessing applications for cytometry data.
#Flowjo serial number free
0 notes
Flowjo serial number free
FLOWJO SERIAL NUMBER FREE CRACKED
FLOWJO SERIAL NUMBER FREE MOVIE
Currently Age Flowjo dongle replacement fee Free Activators Empires 2 HD freeload PC game is the newest expansion pack for the game released after quite a long time.
Age Of Empires 2 HD freeload is basically the second flagship expansion pack for a marvelous strategy game (Age Of Empires 2 The Age Of Kings).
FLOWJO SERIAL NUMBER FREE CRACKED
- freeload PC Games Flowjo dongle replacement fee Free Activators full and complete game & repack from Mega, Uptobox, 1fichier, Turbobit, Uploaded, Zippyshare, bilin.com.mxise, simply click the 'FlowJo Portal Sign In' button at the top and enter your personal Portal account credentials. If you start with a serial number and your lab expands with more computers you can convert. If your computer has been used previously using the prior HWA system, you will need to remove that serial license number located in the middle right of that tab. It is a good option for labs and users who don’t want to worry about losing a dongle (or getting it stolen) or who only have one workstation they will be using for analysis. are the two new lush and splendid tweaks of Age Of Empires 2 HD freeload. A license number will run FlowJo on one, and only one, computer. Treaty and Capture The Relic Lecrae albums freeload. One of the best attributes of this game are the new included Civilizations such as the Indians, Italians, Slavs, flowjo dongle replacement fee Free Activators, and Incas and Magyars. When FlowJo is launched for the first time, the FlowJo license information window will open with the licensing agreement and license options. We encourage you to update to the most recent version of FlowJo. First Name: Last Name: Institution: Country: AFGHANISTAN ALBANIA ALGERIA AMERICAN SAMOA ANDORRA ANGOLA ANGUILLA ANTARCTICA ANTIGUA AND BARBUDA ARGENTINA ARMENIA ARUBA AUSTRALIA AUSTRIA Driver toolkit crack youtube BAHAMAS BAHRAIN BANGLADESH BARBADOS BELARUS BELGIUM BELIZE BENIN. This expansproton of Age Of Empires II is also known as Age Of Empires II The Forgotten freeload. To obtain a trial day serial number so that you may try FlowJo with your data please fill out the form on our day trial serial number page. Please fill in the fields to receive a flowjo dongle replacement fee Free Activators day FlowJo serial number. Currently Age Of Empires 2 HD freeload PC game is the newest expansproton pack for the game released after quite a long time.
FLOWJO SERIAL NUMBER FREE MOVIE
It might be a funny scene, movie quote, animation, meme or a mashup of multiple sources. Age Of Empires 2 HD free download is basically the second flagship expansproton pack for a marvelous strategy game (Age Of Empires 2 The Age Of Kings). You can take any video, trim the best part, combine with other videos, add soundtrack.
#Flowjo serial number free
0 notes
Copytrans activation code generator download
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD FOR MAC#
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD CRACKED#
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD SERIAL KEY#
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD FULL VERSION#
There’ll be programs convey and to share with you the application form.
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD SERIAL KEY#
The application form to store and move connections cloudly can manage by you and the driver deal with the MAC and install at no cost.ĬopyTrans Serial Key variant keeps anyone away from file conversion, improves the i-OS experience, and can help you a whole good deal more time upgrading and program snapping. That is flowjo dongle replacement fee Free Activators, transfers, and music all for all of your devices, flowjo dongle replacement fee Free Activators. That is just a data unit that performs simultaneous purposes such as sharing, data manipulation, and conversion around MAC, IOS, along with Android and handles all.ĬopyTrans Crack is Con-Tact managing perfect tool over Iphones, Ipods, and Ipad pills prepared to copy the utilized plug-in that is data-HEIC using a simple solution up on Windows. The computer software will be here now prepared to allow everybody else.
Connect your iPod, iPhone, or iPad to PC without iTunesĬopyTrans Crack Activation Code Torrent Latest Download For MacĬopyTrans Crack is a control center having to begin a system within mutually that is dual-platform.
What’s New In CopyTrans Crack Latest Version?.
CopyTrans Crack Main Features:.
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD FULL VERSION#
CopyTrans Crack Full Version Torrent Download For Win/Mac:.
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD FOR MAC#
CopyTrans Crack Activation Code Torrent Latest Download For bilin.com.mx restore the original MAC address of the network adapter, select the adapter, click Restore Original button in the Change MAC Address bilin.com.mx may even click Random MAC Address button to fill up a randomly flowjo dongle replacement fee Free Activators MAC address from the vendor list available. Enter new MAC address in the field and click Change Now! button. In the Information tab, find the Change MAC Address bilin.com.mx will get the details of your selection below, flowjo dongle replacement fee Free Activators. Select the adapter you want to change the MAC bilin.com.mxng MAC address changer will list all available network bilin.com.mx can be found in the Advance settings tab in the Network Adapter's Device properties in Windows Device Manager. Some Network Adapter drivers have this facility built-in. If a value is present, windows will use it as MAC address, if not, windows will use flowjo dongle replacement fee Free Activators hard coded manufacturer provided MAC address. When the Network Adapter Device is enabled, windows searches for the registry value 'NetworkAddress' in the key HKEY_LOCAL_MACHINESYSTEMCurrentControlSetControlClass. This software just writes a value into the windows registry. You will then receive a license code which you can put into the software. 2 min - Uploaded by Keygen Free HereFlowJo Crack Full Serial Number + Torrent Mac+Win. Flowjo 10 Serial Number Crack 10 Serial Number Crack.
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD CRACKED#
6 PC x32/圆4 and MAC cracked full download. FlowJo lies within Development Tools, more precisely Database Tools. FlowJo can be downloaded from our website for free, flowjo dongle replacement fee Free Activators. Adobe Illustrator Mac Crack freeload The enterprise-general vector pics software program lets you create emblems, icons, drawings, typography, and illustrations for print, flowjo dongle replacement fee Free Activators, internet, video, and mobile. Apple, in its line of amazing Mac OX titles, launched the Mac OS Yosemite which took the world by storm. Mac OS X Yosemite is another product in Apple’s line of Mac OS X. Note: Let Us Know In the comments if any link is not working, We will update ASAP.
#Copytrans activation code generator download
0 notes
Flowjo Crack
is an evaluation device for applications that gather cytometry data. It produces records in the configuration that is cytometry. Flowjo Serial Key program flowjo dongle replacement fee Free Activators your PC’s information overwhelmingly of information, with help. This is where you’ll track down more prominent chances to accelerate the method involved with phenotyping and immunology. It permits you to test the consequences of your exploration. To introduce your discoveries in better approaches to introduce your discoveries, you may likewise take a gander at more data later to show the effect of the survey of cells.
There is no prerequisite Since FlowJo Serial number tends to configuration savvy projects. A mind-boggling type of utilization’s suitable flowjo dongle replacement fee Free Activators the degree of exploration and provides you with the type of a solitary cell simultaneously. FlowJo Mac Crack is programming for investigating to break down cytometry information. It creates new records involving the standard arrangement for cytometry, flowjo dongle replacement fee Free Activators. FlowJo takes a stab at your information by giving an outstanding wellspring of your information that is completely upheld.
Following that awesome way of saying you really want to gather informational collections, etc, flowjo dongle replacement fee Free Activators. The group is exploring the ramifications that will rely on the application and your longing. Flowjo Full Cracked can assist you with learning numerous headings for stream Cytometry. Near different marvelous gadgets comparably to the different current features will become the smooth out of your tips to redesign the flowjo dongle replacement fee Free Activators example of it.
0 notes
FlowJo Crack + Keygen Download % Working FlowJo Crack is a commercial application that has an integrated environment for viewing and analyzing flow cytometry data. The weather display functions as a workspace, with
#FlowJo FlowJoCrack FlowJoSerialKey FlowJoFreeDownload FlowJoDownload FlowJoSoftware FlowJoMac FlowJoLicenseKey FlowJoFullVersion FlowJoT
0 notes
Abe T., Sugimura K., Hosono Y., Takami Y., Akita M., Yoshimura A., Tada S., Nakayama T., Murofushi H., Okumura K. The histone chaperone facilitates chromatin transcription (FACT) protein maintains normal replication fork rates. J. Biol. Chem. ;–[Europe PMC free article] [Abstract] [Google Scholar]
Adam S., Polo S.E., Almouzni G. Transcription recovery after DNA damage requires chromatin priming by the H histone chaperone HIRA. Cell. ;– [Abstract] [Google Scholar]
Adam S., Dabin J., Chevallier O., Leroy O., Baldeyron C., Corpet A., Lomonte P., Renaud O., Almouzni G., Polo S.E. Real-time tracking of parental histones reveals their contribution to chromatin integrity following DNA damage. Mol. Cell. ;–[Europe PMC free article] [Abstract] [Google Scholar]
Alabert C., Bukowski-Wills J.-C., Lee S.-B., Kustatscher G., Nakamura K., de Lima Alves F., Menard P., Mejlvang J., Rappsilber J., Groth A. Nascent chromatin capture proteomics determines chromatin dynamics during DNA replication and identifies unknown fork components. Nat. Cell Biol. ;–[Europe PMC free article] [Abstract] [Google Scholar]
Alabert C., Barth T.K., Reverón-Gómez N., Sidoli S., Schmidt A., Jensen O.N., Imhof A., Groth A, flowjo dongle replacement fee Free Activators. Two distinct modes for propagation of histone PTMs across the cell cycle. Genes Dev. ;–[Europe PMC free article] [Abstract] [Google Scholar]
Alatwi H.E., Downs J.A. Removal of H2A.Z by INO80 promotes homologous recombination. EMBO Rep. ;–[Europe PMC free article] [Abstract] [Google Scholar]
Allis C.D., Jenuwein T. The molecular hallmarks of epigenetic control. Nat. Rev. Genet. ;– [Abstract] [Google Scholar]
Altmeyer M., Lukas J. To spread or not to spread—chromatin modifications in response to DNA damage. Curr. Opin. Genet. Dev. ;– [Abstract] [Google Scholar]
Atsumi Y., Minakawa Y., Ono M., Dobashi S., Shinohe K., Shinohara A., Takeda S., Takagi M., Takamatsu N., Nakagama H. ATM and SIRT6/SNF2H mediate transient H2AX stabilization when DSBs form by blocking HUWE1 to allow efficient γH2AX foci formation. Cell Rep. ;– [Abstract] [Google Scholar]
Bannister A.J., Kouzarides T. Regulation of chromatin by histone modifications. Cell Res, flowjo dongle replacement fee Free Activators. ;–[Europe PMC free article] [Abstract] [Google Scholar]
Bassing C.H., Chua K.F., Sekiguchi J., Suh H., Whitlow S.R., Fleming J.C., Monroe B.C., Ciccone D.N., Yan C., Vlasakova K. Increased ionizing radiation sensitivity and genomic instability in the absence of histone H2AX. Proc. Natl. Acad. Sci. USA. ;–[Europe PMC free article] [Abstract] [Google Scholar]
Bensaude O. Inhibiting eukaryotic transcription: which compound to choose? How to evaluate its activity? Transcription. ;–[Europe PMC free article] [Abstract] [Google Scholar]
Bodor D., Rodríguez M., Moreno N. Analysis of protein turnover by quantitative SNAP-based pulse-chase imaging. Curr. Protoc. Cell Biol. ;Chapter 8 Unit [Abstract] [Google Scholar]
Boyarchuk E., Filipescu D., Vassias I., Cantaloube S., Almouzni G. The histone variant composition of centromeres is controlled by the pericentric heterochromatin state during the cell cycle. J. Cell Sci. ;– [Abstract] [Google Scholar]
Buschbeck M., Hake S.B. Variants of core histones and their roles in cell fate decisions, development and cancer. Nat. Rev. Mol. Cell Biol. ;– [Abstract] [Google Scholar]
Chen C.-C., Carson J.J., Feser J., Tamburini B., Zabaronick S., Linger J., Tyler J.K. Acetylated lysine 56 on histone H3 drives chromatin assembly after repair and signals for the completion of repair. Cell. ;–[Europe PMC free article] [Abstract] [Google Scholar]
Ciccia A., Elledge S.J. The DNA damage response: making it safe to play with knives. Mol. Cell, flowjo dongle replacement fee Free Activators. ;–[Europe PMC free article] [Abstract] [Google Scholar]
Dabin J., Fortuny A., flowjo dongle replacement fee Free Activators, Polo S.E, flowjo dongle replacement fee Free Activators. Epigenome maintenance in response to DNA damage. Mol. Cell. ;–[Europe PMC free article] [Abstract] [Google Scholar]
Dantuma N.P., van Attikum H. Spatiotemporal regulation of posttranslational modifications in the DNA damage response. EMBO J. ;–[Europe PMC free article] [Abstract] [Google Scholar]
Diao L.-T., Chen C.-C., Dennehey B., Pal S., Wang P., Shen Z.-J., Deem A., Tyler J.K. Delineation of the role of chromatin assembly and the RttMms1 E3 ubiquitin ligase in DNA damage checkpoint recovery in budding yeast. PLoS ONE. ;e[Europe PMC free article] [Abstract] [Google Scholar]
Dinant C., Ampatziadis-Michailidis G., Lans H., Tresini M., Lagarou A., Grosbart M., Theil A.F., van Cappellen W.A., Kimura H., Bartek J. Enhanced chromatin dynamics by FACT promotes transcriptional restart after UV-induced DNA damage. Mol. Cell. ;– [Abstract] [Google Scholar]
Dunleavy E.M., Almouzni G., Karpen G.H. H is deposited at centromeres in S phase as a placeholder for newly assembled CENP-A in G1 phase. Nucleus. ;–[Europe PMC free article] [Abstract] [Google Scholar]
Fan J.Y., Gordon F., Luger K., Hansen J.C., Tremethick D.J. The essential histone variant H2A.Z regulates the equilibrium between different chromatin conformational states. Nat. Struct. Biol. ;– [Abstract] [Google Scholar]
Fan J., Otterlei M., Wong H.-K., flowjo dongle replacement fee Free Activators, Tomkinson A.E., Wilson D.M., 3rd XRCC1 co-localizes and physically interacts with PCNA. Nucleic Acids Res. ;–[Europe PMC free article] [Abstract] [Google Scholar]
Fan J.Y., Rangasamy D., Luger K., Tremethick D.J. H2A.Z alters the nucleosome surface to promote HP1alpha-mediated chromatin fiber folding. Mol. Cell, flowjo dongle replacement fee Free Activators. ;– [Abstract] [Google Free crack software download sites Activators Patch Y., Li C., Wei L., Teng Y., Nakajima S., Chen X., Xu J., Leger B., Ma H., Spagnol S.T. SSRP1 cooperates with PARP and XRCC1 to facilitate single-strand DNA break repair by chromatin priming. Cancer Res. ;–[Europe PMC free article] [Abstract] [Google Scholar]
Gasparian A.V., Burkhart C.A., Purmal A.A., Brodsky L., Pal M., Saranadasa M., Bosykh D.A., flowjo dongle replacement fee Free Activators, Commane M., Guryanova O.A., Pal S. Curaxins: anticancer compounds that simultaneously suppress NF-κB and activate p53 by targeting FACT. Sci. Transl. Med. ;ra[Europe PMC free article] [Abstract] [Google Scholar]
Gursoy-Yuzugullu O., Ayrapetov M.K., Price B.D. Histone chaperone Anp32e removes H2A.Z from DNA double-strand breaks and promotes nucleosome reorganization and DNA repair. Proc. Natl. Acad. Sci. USA. ;–[Europe PMC free article] [Abstract] [Google Scholar]
Hanasoge S., Ljungman M. H2AX phosphorylation after UV irradiation is triggered by DNA repair intermediates and is mediated by the ATR kinase. Carcinogenesis. ;– [Abstract] [Google Scholar]
Heo K., Kim H., Choi S.H., Choi J., Kim K., Gu J., Lieber M.R., Yang A.S., An W. FACT-mediated exchange of histone variant H2AX regulated by phosphorylation of H2AX and ADP-ribosylation of Spt Mol. Cell. ;– [Abstract] [Google Scholar]
Herrera-Moyano E., Mergui X., García-Rubio M.L., Barroso S., Aguilera A. The yeast and human FACT chromatin-reorganizing complexes solve R-loop-mediated transcription-replication conflicts. Genes Dev. ;–[Europe PMC free article] [Abstract] [Google Scholar]
Hoeijmakers J.H.J. DNA damage, aging, flowjo dongle replacement fee Free Activators, and cancer. N. Engl. J. Med. ;– [Abstract] [Google Scholar]
Despina Siolas,1,2,*Emily Vucic,3Emma Kurz,4Cristina Hajdu,5 and Dafna Bar-Sagi6,7,*
1Department of Medicine, New York University Grossman School of Medicine, New York, NY, USA
2Laura and Isaac Perlmutter Cancer Center, New York University Grossman School of Medicine, New York, NY, USA
Find articles by Despina Siolas
3Department of Biochemistry and Molecular Pharmacology, New York University Grossman School of Medicine, New York, NY, USA
Find articles by Emily Vucic
4Molecular Oncology and Tumor Immunology Training Program, NYU Grossman School of Medicine, New York, NY, USA
Find articles by Emma Kurz
5Department of Pathology, NYU Langone Health, New York, NY, USA
Find articles by Cristina Hajdu
6Department of Biochemistry and Molecular Pharmacology, New York University Grossman School of Medicine, New York, NY, USA
7Lead contact
Find articles by Dafna Bar-Sagi
Author informationCopyright and License informationDisclaimer
1Department of Medicine, New York University Grossman School of Medicine, New York, NY, USA
2Laura and Isaac Perlmutter Cancer Center, New York University Grossman School of Medicine, New York, NY, USA
3Department of Biochemistry and Molecular Pharmacology, New York University Grossman School of Medicine, New York, NY, USA
4Molecular Oncology and Tumor Immunology Training Program, NYU Grossman School of Medicine, New York, Download teamviewer 14 full crack Activators Patch, USA
5Department of Pathology, NYU Langone Health, New York, NY, USA
6Department of Biochemistry and Molecular Pharmacology, New York University Grossman School of Medicine, New York, NY, USA
7Lead contact
AUTHOR CONTRIBUTIONS
The study was conceived and designed by D.S, flowjo dongle replacement fee Free Activators. and D.B.S, flowjo dongle replacement fee Free Activators. Investigations were conducted by D.S., E.K., E.V., and C.H. Bioinformatics analysis was carried out by E.V. The manuscript was written by D.S., E.V., and D.B.S., and all authors reviewed the paper.*Correspondence: bilin.com.mxluyn@bilin.com.mxd (D.S.), bilin.com.mxluyn@bilin.com.mx (D.B.-S.)
Copyright notice
The publisher's final edited version of this article is available free at Cell Rep
This paper analyzes existing, publicly available data. These accession numbers for the datasets are listed in the key resources table.
KEY RESOURCES TABLE
| REAGENT or RESOURCE Antibodies | SOURCE | IDENTIFIER | ||
|---|---|---|---|---|
| APC/Cy7 anti-mouse CD3 (17A2) | BioLegend | Cat# ; RRID:AB_ | ||
| BV CD45 (F11) | BioLegend | Cat# ; RRID:AB_ | ||
| PE anti-mouse Flowjo dongle replacement fee Free Activators (BM8) | BioLegend | Cat# ; RRID:AB_ | ||
| PE anti-mouse Foxp3 (FJK s) | Invitrogen | Cat# ; RRID:AB_ | ||
| APC/Cy7 anti-mouse CD11b (M1/70) | BioLegend | Cat# ; RRID:AB_ | ||
| PE anti-mouse CD80 (A1) | BioLegend | flowjo dongle replacement fee Free Activators ; RRID:AB_ | ||
| PerCP/Cy anti-mouse CTLA4 (UCB9) | BioLegend | Cat# ; RRID:AB_ | ||
| APC/Cy7 anti-mouse MHCII I-A/I-E (M5/) | BioLegend | Cat# ; RRID:AB_ | ||
| PE anti-mouse Gr1 (RBC5) | BioLegend | Cat# ; RRID:AB_ | ||
| APC anti-mouse Ly6G (1A8) | BioLegend | Cat# ; RRID:AB_ | ||
| APC anti-mouse CD (CC2) | BioLegend | Cat# ; RRID:AB_ | ||
| Mouse BD Fc Block (G2) | BD pharmingen | Cat# ; RRID:AB_ | ||
| PE mouse anti-mouse T-Bet (4B10) | BD pharmingen | Cat# ; RRID:AB_ | ||
| APC anti-mouse CD4 (GK) | BioLegend | Cat# ; RRID:AB_ | ||
| PE/Cy7 CD8 () | BioLegend | Cat# ; RRID:AB_ | ||
| PerCP/Cy anti-mouse CD8 () | BioLegend | Cat# ; RRID:AB_ | ||
| PerCP/Cy anti-mouse CD86 (GL-1) | BioLegend | Cat# ; RRID:AB_ | ||
| PerCP/Cy Ep-CAM (G) | BioLegend | Cat# ; RRID:AB_ | ||
| PerCP/Cy anti-mouse PD1 (29F.1A12) | BioLegend | Cat# ; RRID:AB_ | ||
| Pe/Cy7 anti-mouse IFN-g (XMG) | BioLegend | Cat# ; RRID:AB_ | ||
| PE anti-mouse CD31 () | BioLegend | Cat# ; RRID:AB_ | ||
| Pe/Cy7 anti-mouse PDGFRa (APA5) | crack software download pc Free Activators colspan="1">BioLegend | Cat# ; RRID:AB_ | ||
| PE anti-mouse CD11c (N) | BioLegend | Cat# ; RRID:AB_ | ||
| PE IgG1k isotype control | Invitrogen | Cat# ; RRID:AB_ | ||
| Pe/Cy7 Rat IgG1 isotype control | BioLegend | Cat# ; RRID:AB_ | ||
| InVivo rat IgG2a mAb (2A3) isotype control | BioXCell | Cat# BE; RRID:AB_ | ||
| InVivoMAb monoclonal anti-mouse Ly6G (1A8) | BioXCell | Cat# BE; RRID:AB_ | ||
| InVivoMAb CD40 rat anti-mouse IgG2a mAb (FGK45) | BioXCell | Cat# BE; RRID:AB_ | ||
| InVivoMAb anti-rat Kappa Immunoglobulin Light Chain | BioXCell | Cat# BE; RRID:AB_ | ||
| APC anti-mouse CD34 (HM34) | BioLegend | Cat #; RRID:AB_ | ||
| MPO antibody | Santa Cruz | Cat# sc; RRID:AB_ | ||
| Neutrophil Marker (NIMP-R14) antibody | Santa Cruz | Cat# sc; RRID:AB_ | ||
| P53 (1C12) Mouse antibody | Cell Signaling | Cat# S; RRID:AB_ | ||
| Anti-Vinculin mouse antibody | SigmaAldrich | Cat# V; RRID:AB_ | ||
| Bacterial and virus strains | ||||
| STBL3 | ThermoFisher | Cat# C | ||
| Chemicals, Peptides, and Recombinant Proteins | ||||
| Nab-paclitaxel | Celgene | Cat# | ||
| Gemcitabine | Hospira | Cat# | ||
| Albumin | Sigma Glary Utilities Pro 5.173.0.201 Crack Plus Key {Lifetime} rowspan="1" colspan="1">Cat# A | |||
| Xtremegene 9 | Roche | Cat# 06 | ||
| Polybrene | Sigma Aldrich | Cat# TRG | ||
| Hygromycin | Sigma Aldrich | Cat# | ||
| G | Sigma Aldrich | Cat# | ||
| PfIFI | New England Biolabs | Cat# RS | ||
| BsmBI | New England Biolabs | Cat#RS | ||
| Shield-1 | Cheminpharma | Cat# S | ||
| Lipofectamine | Life Technologies | Cat# L | ||
| Critical commercial assays | ||||
| Surveyor DNA mutation Kit | IDT | Cat# | ||
| TOPO TA Cloning Kit | Thermo-Fisher | Cat# KJ10 | ||
| SYBR Green PCR Master Mix | Thermo-Fisher | Cat# | ||
| Quantitect Reverse Transcription Kit | QIAGEN | flowjo dongle replacement fee Free Activators colspan="1">Cat# | ||
| Zombie Green Fixable Viability Kit | Biolegend | Cat# | ||
| RNeasy Mini Kit | QIAGEN | Cat# | ||
| Milliplex Mouse Cytokine Magnetic Bead Panel | Millipore Sigma | Cat# MCYTOMAGK | ||
| KAPA Mouse Genotyping Kit | Roche | Cat# | ||
| Foxp3/Transcription Factor Staining Buffer Set | Invitrogen | Cat# | ||
| Experimental models: Cell lines | ||||
| HEKT | ATCC | Cat# ATCC® CRL | ||
| KrasG12D/+;Trp53+/+PDEC | Pylayeva-Gupta et al., | iobit uninstaller 8.5 crack Activators Patch rowspan="1" colspan="1">KrasG12D/+;Trp53/ PDEC | This manuscript | N/A |
| KrasG12D/+;Trp53RH/+PDEC | This manuscript | N/A | ||
| Experimental models: Organisms/strains | ||||
| C57Bl6/J mice females (weeks) | Charles River Laboratories | CR: | ||
| Oligonucleotides | ||||
| p53 sgRNA, CGG AGC AGC GCT CAT GGT GG | This manuscript | N/A | ||
| p53 HDR template, CAC CTC CAG CTG GGA GCC GTG TCC GCG CCA TGG CCA TCT ACA AGA AGT CAC AGC ACA TGA CGG AAG TCG TGA GAC Flowjo dongle replacement fee Free Activators GTC CCC ACC ATG AGC GCT GCT CCG ATG GTG ATG GTA AGC CCT CAA CAC CGC CTG TGG GGT TAG GAC TGG CAG | This manuscript | N/A | ||
| p53 Forward PCR primer, TGGGA CAGCCAAGTCTGTTA | This manuscript | N/A | ||
| p53 Reverse PCR primer CCTGCT GTCTCCAGACTCCT | This manuscript | N/A | ||
| shScramble CCGGTCCTAAGGTTA AGTCGCCCTCGCTCGAGCGAGGG CGACTTAACCTTAGGTTTT | Sarbassov et al., | Addgene Cat # | ||
| CXCL2 forward PCR primer ATGC CTGAAGACCCTGCCAAG | Roy et al., | N/A | ||
| CXCL2 reverse PCR primer GGTC AGTTAGCCTTGCCTTTG | Roy et al., | N/A | ||
| CXCL5 forward PCR primer ACAGT GCCCTACGGTGGAAGT | Roy et al., | N/A | ||
| CXCL5 reverse PCR primer CGAGT GCATTCCGCTTAGCTT | Roy et al., | N/A | ||
| Recombinant DNA | ||||
| pLKO.1 neo | Gift from Sheila Stewart | Addgene Cat# | ||
| psPAX2 | Gift from Didier Trono | Addgene Cat# | ||
| pMD2G | Gift from Didier Trono | Addgene Cat# | ||
| pLKO.1 hygro | Gift from Bob Weinberg | Addgene Cat# | ||
| LentiCRISPRv2 hygro | Stringer et al., | Addgene Cat# | ||
| conditional EDCPV | Gift from R. Sordella, Cold Spring Harbor Laboratory | N/A | ||
| Software and algorithms | ||||
| ImageJ | Schneider et al., | bilin.com.mx; RRID:SCR_ | ||
| FlowJo version | FlowJo | bilin.com.mx; RRID:SCR_ | ||
| R version | RStudio | bilin.com.mx; RRID:SCR_ | ||
| Prism Version 7 | GraphPad | bilin.com.mx; RRID:SCR_ | ||
| Vevo Lab | FUJIFILM-VisualSonics | bilin.com.mx | ||
| Other | ||||
| Whole-Tissue Gene Expression Data of Pancreatic Ductal Adenocarcinoma | Badea et al., | GSE | ||
| Expression data from Mayo Clinic Pancreatic Tumor and Normal samples | Pei et al., | GSE | ||
Open in a separate window
All data reported in this paper will be shared by the lead contact upon request.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
Tumor genotype can influence the immune microenvironment, which plays a critical role in cancer development and therapy resistance. However, the immune effects of gain-of-function Trp53 mutations have not been defined in pancreatic cancer. We compare the immune profiles generated by KrasG12D-mutated mouse pancreatic ductal epithelial cells (PDECs) engineered genetically to express the Trp53RH mutation with their p53 wild-type control. KrasG12D/+;Trp53RH/+ tumors have a distinct immune profile characterized by an influx of CD11b+Ly6G+ neutrophils and concomitant decreases in CD3+ T cells, CD8+ T cells, and CD4+ T helper 1 cells. Knockdown of CXCL2, a neutrophil chemokine, in the tumor epithelial compartment of CRISPR KrasG12D/+;Trp53RH/+ PDEC tumors reverses the neutrophil phenotype. Neutrophil depletion of mice bearing CRISPR KrasG12D/+;Trp53RH/+ tumors augments sensitivity to combined CD40 immunotherapy and chemotherapy. These data link Trp53RH to the presence of intratumoral neutrophils in pancreatic cancer and suggest that tumor genotypes could inform selection of affected individuals for immunotherapy.
Siolas et al. demonstrate that the gain-offunction Trp53RH mutation promotes CD11b+Ly6G+ neutrophil recruitment to KrasG12D pancreatic tumors, which is distinct from tumors with loss-of-function or wild-type flowjo dongle replacement fee Free Activators. The presence of neutrophils in the tumor microenvironment promotes resistance to combination CD40 immunotherapy and chemotherapy treatment, suggesting that tumor genotype may guide therapy selection.
Pancreatic ductal adenocarcinoma (PDAC) is an intractable disease with a low survival rate, limited treatment options, and a poor therapy response rate (Raj et al., ). This is in part due to the immunosuppressive and fibrotic microenvironment of pancreatic tumors (Murakami et al., ). PDAC progression is typified by a multitude of immunosuppressive cells, including regulatory T cells, myeloid-derived suppressor cells (MDSCs), neutrophils, and tumor-associated macrophages (TAMs), leading to immune evasion (Hiraoka et al., ; Ho et al., ; Lesina et al., ; Steele et al., ). There is an urgent need to increase our understanding of how tumors create an immunosuppressive microenvironment that leads to tumor growth and therapy resistance (Martinez-Bosch et al., ).
Different tumor genetic backgrounds can profoundly influence the composition of the immune microenvironment, as demonstrated in melanoma, breast, and prostate cancers, through distinct cellular mechanisms (Bezzi et al., ; Spranger et al., ; Wellenstein et al., ). For example, activation of ²-catenin signaling in melanoma cells leads to T cell exclusion and resistance to checkpoint immunotherapy in genetically engineered mouse models (GEMMs) (Spranger et al., ). In prostate cancer GEMMs, loss of the tumor suppressor gene Pten alone or in combination with loss of Trp53, Zbtb7a, or Pml resulted in diverse immune profiles affecting MDSCs, monocytes, and T cells (Bezzi et al., ). Although changes to the immune microenvironment over time have been described during development of pancreatic flowjo dongle replacement fee Free Activators, how distinct immune cell populations correlate to specific tumor genotypes has not been determined (Clark et al., ).
In PDAC, KRAS mutations are an initiating genetic event and the most frequent gene alteration, occurring in over 90% of tumors (Raphael et al., ), flowjo dongle replacement fee Free Activators. Several labs have demonstrated that KRASG12D mutations in tumor cells remodel the pancreatic immune microenvironment by recruiting immunosuppressive MDSCs and regulatory T cells (Bayne et al., ; Mathew et al., ; Pylayeva-Gupta et al., ; Zhang et al., ), but the effects of additional mutations have not been explored.
TP53 is mutated in up to 70% of PDACs, second in mutation frequency only to KRAS (Raphael et al., ). Homozygous TP53 deletions, flowjo dongle replacement fee Free Activators in less than 2% of tumors, are a much rarer genetic event than p53 mutation in human PDAC (Raphael et al., ). Trp53 deletions occurring in flowjo dongle replacement fee Free Activators context of oncogenic Kras mutations have been demonstrated experimentally to drive recruitment of CD11b+F+ macrophages in autochthonous pancreatic tumor models through increased expression of CXCR3and CCR2-associated chemokines and macrophage colony-stimulating factor (M-CSF) (Blagih et al., ). However, most alterations affecting TP53 in human PDAC are missense mutations affecting the DNA-binding domain, which may be gain-of-function mutations that bestow neomorphic capabilities or loss-of-function mutations that abrogate its tumor suppressor activity (Pfister and Prives, ).
An integrated genomics analysis of human PDACs defined four subtypes of pancreatic cancer (Bailey et al., ). In particular, the squamous subtype is correlated with TP53 mutations and has been observed to be enriched for a distinct immune cell-specific gene expression signature (Bailey et al., ). A separate study found that the human PDAC squamous subtype was enriched significantly for infiltration of tumor-associated neutrophils, suggesting a connection between TP53 mutations and neutrophils (Chao et al., ). In addition, tumors from KrasG12D;Trp53RH;Cxcr2/ - GEMM mice, whose intratumoral neutrophil recruitment is abrogated because of deletion of flowjo dongle replacement fee Free Activators CXCR2 receptor, had decreased expression of genes associated with the PDAC squamous subtype compared with controls (Chao et al., ; Steele et al., ). Neutrophil presence (Chao et al., ; Steele et al., ) and Trp53RH gain-of-function mutation in tumor cells (Morton et al., ; Weissmueller et al., ) have been implicated independently in promoting metastasis in mouse models of PDAC. Although these studies implicate the Trp53RH mutation in mediating immune regulation, the immune effects directly attributable to acquisition of the gain-of-function Trp53RH mutation in pancreatic ductal epithelial cells have not been characterized.
Here we used CRISPR-Cas9 to engineer a Trp53RH mutation in primary murine pancreatic ductal epithelial cells (PDECs) derived from genetically engineered KrasG12D mice. Orthotopic implantation of these cell lines into wild-type immunocompetent C57BL/6 mice revealed that CRISPR KrasG12D/+;Trp53RH/+ PDEC tumors have a distinct immune profile characterized by an increase in intratumoral neutrophils and a concomitant decrease in T cells compared with KrasG12D/+;Trp53+/+ lesions. Correspondingly, CRISPR KrasG12D/+;Trp53RH/+ PDEC tumor epithelial cells produced elevated levels of two chemokines involved in neutrophil accumulation, CXCL2 and Ivacy vpn crack Crack Key For U, but only knockdown of CXCL2 in CRISPR KrasG12D/+;Trp53RH/+ PDEC tumors abrogated neutrophil recruitment. Finally, depletion of neutrophils from CRISPR KrasG12D/+;Trp53RH/+ PDEC tumors augmented sensitivity to CD40 agonist combination chemotherapy and immunotherapy. These results support a role of the intratumoral Trp53RH mutation in modulating the tumor microenvironment in pancreatic cancer and mediating therapeutic response to immunotherapy.
To understand the potential connection between the immune microenvironment and gain-of-function mutant Trp53RH, we used PDECs obtained from KrasG12D/+;Trp53+/+ GEMMs. Because these can be cultivated ex vivo (Pylayeva-Gupta et al., ), they are amenable to genetic targeting, allowing us to focus selectively on Trp We targeted the most common TP53 mutation in human pancreatic cancer, RH (Bailey et al., ; Witkiewicz et al., ), which is the equivalent of mouse RH. To create isogenic PDEC lines with a defined Trp53 mutation while minimizing off-target effects, we selected a conditional CRISPR-Cas9 gene editing platform in which a FKBPderived destabilizing domain is fused to Cas9 (DD-Cas9), flowjo dongle replacement fee Free Activators, enabling conditional Cas9 expression and temporal control of gene editing in the presence of an FKBP12 small-molecule synthetic ligand, flowjo dongle replacement fee Free Activators, Shield-1 (Senturk et al., ). Following genetic sequence verification, CRISPR KrasG12D/+;Trp53+/+ or KrasG12D/+;Trp53RH/+ cells were implanted orthotopically into the pancreata of wild-type mice, and tumors that formed were harvested 2 weeks later (Figure 1A). Compared with KrasG12D/+;Trp53+/+ tumors, CRISPR KrasG12D/+;Trp53RH/+ flowjo dongle replacement fee Free Activators had a higher tumor volume and weight (Figure 1B) and displayed more aggressive histological features, including a complex architecture consisting of poor gland formation, flowjo dongle replacement fee Free Activators, predominantly solid tumor growth, flowjo dongle replacement fee Free Activators, and abundant neutrophilic inflammatory infiltrates (Figure 1C), indicating that the edited Trp53RH mutation promoted neoplastic progression.
Open in a separate window
Figure 1.
(A) Experimental design. Representative gross tumors are shown.
(B) Tumor weight. Each dot represents one mouse. n = 6. Mathematica for students bars, ± SD.
(C) Representative images of tumor sections stained by HE; scale bars, ¼m.
(D) mRNA transcript levels as measured by qPCR. The graph shows quantification of the ratio of transcripts for doxorubicin-treated versus untreated cells. Error bars, ± SEM.
(E) Left: representative images of tumor sections stained for CK19, Ki, and DAPI flowjo dongle replacement fee Free Activators immunofluorescence. Scale bars, ¼m. Right: Ki quantification per field of view. Each point on the graph represents one mouse; flowjo dongle replacement fee Free Activators = 5 (KrasG12D/+; Trp53RH/+), flowjo dongle replacement fee Free Activators, n = 4 (KrasG12D/+;Trp53+/+). Error bars, ± SD.
For (B), flowjo dongle replacement fee Free Activators, (D), and (E), Students t test flowjo dongle replacement fee Free Activators, unpaired); *p **p ****p
Next we sought to confirm the functionality of mutant Trp53RH in CRISPR-Cas9-modified cells by examining the expression of well-established target genes of Trp53RH. Specifically, we chose to focus on the Ccna, Ccnb1, Ccnb2, and Cdk1 cell cycle control genes, whose expression has been shown to increase after DNA damage through Trp53RHdependent activation of nuclear transcription factor Y (NF-Y) (Di Agostino et al., ). Exposure of CRISPR-Cas9-modified cells to the DNA-damaging agent doxorubicin was accompanied by higher expression of Ccna, Ccnb1, Ccnb2, and Cdk1 in CRISPR KrasG12D/+;Trp53RH/+ cells in comparison with KrasG12D/+;Trp53+/+ cells (Figure 1D), consistent with the gain-of-function mode of action attributed to this mutation. In addition, CRISPR KrasG12D/+;Trp53RH/+ tumors displayed higher proliferative rates compared with KrasG12D/+;Trp53+/+ tumors, as determined by epithelium-associated Ki staining (Figure 1E). Our analyses demonstrate the feasibility of introducing a Trp53RH gain-of-function mutation using a conditionally active CRISPR-Cas9 system and the utility of this approach for creation of an isogenic model system to pursue Trp53RH functional studies.
To assess the immune landscape of gain-of-function mutant Trp53RH tumors, we performed immune profiling of mouse orthotopic tumors using multicolor flow cytometry 2 weeks after implantation. CRISPR KrasG12D/+;Trp53RH/+ tumors displayed a significantly elevated proportion of tumor-associated neutrophils (CD11b+Ly6G+) in comparison with KrasG12D/+;Trp53+/+ lesions (Figure 2A). This was confirmed by immunohistochemistry (IHC) analysis (Figure S1A) and remains significant when accounting for tumor weight (Figure S1B). The infiltration of neutrophils is in contrast to the lack of observed changes in other cells of myeloid lineage, including TAMs (CD11b+F+), M1 (F+MHCII+CD80+CD86+) or M2 (F+MHCIICD+) macrophages (Figures 2B2D), CD11c+ dendritic cells, or CD11c+major histocompatibility complex (MHC) class II+ classical dendritic cells (Figures S1C and S1D).
Open in a separate window
Figure 2.
(AG) Flow cytometric plots and quantification of (A) neutrophils, (B) TAMs, (C) M1 macrophages, (D) M2 macrophages, (E) CD3+ T cells, flowjo dongle replacement fee Free Activators, (F) T helper cells and CD8+ T cells, and (G) Th1 cells. n = 68; error bars, ± SD. Students t test flowjo dongle replacement fee Free Activators, unpaired). **p ****p ; n.s., not significant.
(H) Flow cytometry plots (left) and quantification (right) of neutrophils from orthotopically implanted CRISPR KrasG12D/+;Trp53+/+ tumors or CRISPR KrasG12D/+; Trp53/ tumors. n = 8; error bars, ± SD. Students t test (two-tailed, unpaired).
(I) Gene Ontology analysis of the human TCGA PDAC cohort for genes differentially expressed with p in p53 wild-type (n = 63) compared with p53 mutant tumors (n = 58), highlighting the top significantly altered immune related pathways. See also Figures S1S3.
Examination of the T cell compartment in CRISPR-generated tumors by flow cytometry demonstrated decreases in CD3+ T cells, CD8+ T cells, and Th1 helper cells (CD4+Tbet+) in CRISPR KrasG12D/+;Trp53RH/+ tumors, but there were no changes in Flowjo dongle replacement fee Free Activators T cells (Figures 2E2G). The observed changes in the T cell compartment are consistent with published reports demonstrating an inverse relationship between neutrophil accumulation and T cell infiltration in pancreatic cancer (Chao et al., ; Steele et al., ). There were no observed changes in CD4+Foxp3+ regulatory T cells or PD1+ CD8+ T cells (Figures S1E and S1F). All flow cytometry analyses were carried out using three independent sequence-verified CRISPR-Cas9-modified clones from each genotype (Figures Eset internet security license key 2022. No significant inter-clonal variations were observed, ruling out the possibility that the observed immune profiles are clone dependent. Furthermore, immunofluorescence detection of neutrophils in pancreatic tumors derived from mouse models of autochthonous PDAC driven by a pancreas-specific G12D mutation in KRAS that carried wildtype p53 (KC model: KrasLSL-G12D/+; Trp53+/+;p48Cre/+) or the pancreas-specific RH mutation in p53 (KPC model: KrasLSL-G12D/+;Trp53LSL-RH/+;p48Cre/+) revealed a significantly higher neutrophil density number, as indicated by the higher number of myeloperoxidase (MPO+) cells in KPC tumors compared with KC tumors (Figure S3A). These data suggest that acquisition of the gain-of-function Trp53RH mutation leads to intratumoral neutrophil accumulation. To examine whether this immune phenotype is specific to the Trp53RH mutation, we used CRISPR-Cas9 gene editing to create a homozygous p53 deletion in our KrasG12D/+;Trp53+/+ PDECs (Figure S3B). CRISPR KrasG12D/+;Trp53/ orthotopic tumors did not display an increase in intratumoral neutrophil accumulation compared with CRISPR KrasG12D/+;Trp53+/+ tumors (Figure 2H; Figure S3C), indicating that the Trp53RH mutation exerts a distinct immune phenotype to the tumor microenvironment.
To further explore this observation, we examined the human pancreatic adenocarcinoma cohort from The Cancer Genome Atlas (TCGA) for genes significantly differentially expressed (p ) between tumors with missense mutations in the DNA binding domain flowjo dongle replacement fee Free Activators TP53 compared with tumors with wild-type TP Highly frequent hotspot missense mutations located in the p53 DNA binding domain are a key feature of gain-of-function activity (Bargonetti and Prives, ). Although multiple metabolic pathways associated with mutant TP53 function (Alvarado-Ortiz et al., ; Liu et al., ) were highly upregulated by Gene Ontology analysis in the mutated PDAC tumors, neutrophil-related pathways, including neutrophil-mediated immunity, neutrophil activation, and neutrophil degranulation, were also enriched significantly (Figure 2I). Because of the strong association between purported gain-of-function p53 mutations and neutrophils in pancreatic cancer in humans and mice, we focused on the mechanism of neutrophil infiltration in Trp53RH tumors.
Neutrophil recruitment is mainly mediated by chemokines that have a glutamate-leucine-arginine motif (ELR+ chemokines), which consist primarily of CXCL1, CXCL2, and CXCL5 (Disteldorf et al., ). CXCR2, flowjo dongle replacement fee Free Activators, a G-protein-coupled receptor, regulates neutrophil migration through these chemokines (Jaffer and Ma, ). Human PDAC tumors display increased expression of CXCL2 and CXCL5 in comparison with normal pancreas (Figure 3A), suggesting that production of these chemokines may be responsible for intratumoral neutrophil accumulation. To assess the relevance of this recruitment mechanism to the infiltration of neutrophils observed in CRISPR KrasG12D/+; Trp53RH/+ tumors, we analyzed the relative levels of CXCL2 and Flowjo dongle replacement fee Free Activators production by quantitative PCR (qPCR) in tumor epithelial iobit smart defrag portable Crack Key For U (CD45PDGFRCD34EPCAM+ epithelium) and CD45+ intratumoral immune cells isolated by flow cytometry from CRISPR KrasG12D/+;Trp53RH/+or KrasG12D/+;Trp53+/+ tumors. The epithelial compartment of CRISPR KrasG12D/+; Trp53RH/+ tumors displayed significantly higher levels of Cxcl2 and Cxcl5 expression than the epithelial compartment of CRISPR KrasG12D/+;Trp53+/+ tumors (Figure 3B). Enhanced production of the CXCL2 and CXCL5 chemokines in the CRISPR KrasG12D/+;Trp53RH/+ tumors in comparison to KrasG12D/+; Trp53+/+ was confirmed using mouse chemokine magnetic bead multiplex immunoassay (Figure S3D). Focusing on CRISPR KrasG12D/+;Trp53RH/+ tumors, we found that CXCL5 expression was significantly higher in tumor epithelial cells than in the immune cell compartment, whereas the reverse was true for CXCL2 expression (Figure S3E). High levels of CXCL2 in the microenvironment are not unexpected because neutrophils can express abundant CXCL2 to amplify neutrophil recruitment and activation in an autocrine and/or paracrine manner (Li et al., ).
Open in a separate window
Figure 3.
(A) mRNA transcript levels in PDACs compared with normal adjacent tissue (n = 75 PDACs and n = 55 adjacent normal cells). Each data point indicates an individual tissue sample. Error bars, ± SD.
(B) mRNA expression levels as measured by qPCR. Error bars, ± SEM; n = 3 using pooled samples of 5 tumors each.
(C) mRNA expression levels in vitro measured by qPCR. Error JetBrains IntelliJ IDEA Ultimate License key, ± SEM; n = 34.
(D) Gross histology (top) and graph of tumor weight (bottom, in milligrams) from CRISPR KrasG12D/+;Trp53RH/+ tumors stably expressing scramble shRNA (shScr) and shRNA specific for CXCL5 (shCXCL5) or CXCL2 (shCXCL2). Error bars, ± SD.
(EJ) Representative flow cytometry plots and quantification of (E) neutrophils, (F) CD3+ T cells, (G) T helper cells, (H) CD8+ T cells, (I) Th1 cells, and (J) regulatory T cells, flowjo dongle replacement fee Free Activators. Each dot represents one mouse. Error bars, ± SD. For (A)(J), Students t test (two-tailed, unpaired); *p **p ***p ****p See also Figure S3.
To examine whether intratumoral neutrophil mediamonkey windows media player Free Activators is mediated by chemokines generated by tumor epithelial cells, we stably transfected short hairpin RNAs (shRNAs) targeting CXCL2 or CXCL5 or a scramble hairpin control into CRISPR KrasG12D/+;Trp53RH/+ cells. These hairpins induced more than 80% knockdown efficiency, as assessed by qPCR of in vitro mRNA (Figure 3C). Two weeks after orthotopic implantation, CRISPR KrasG12D/+;Trp53RH/+ tumors with a CXCL2 or CXCL5 hairpin how to download and install adobe acrobat xi pro Crack Key For U smaller in size (Figure 3D), consistent with published reports showing that these chemokines affect tumor growth (Keeley et al., ; Zhao et al., ). Furthermore, CRISPR KrasG12D/+;Trp53RH/+ tumors bearing a CXCL2 hairpin showed fewer intratumoral neutrophils than tumors bearing a scramble control hairpin (Figure 3E). Flow cytometry analysis of CRISPR KrasG12D/+;Trp53RH/+ shCXCL2 tumors demonstrated a greater abundance of CD3+, CD4+, and CD8+ T cells compared to scramble hairpin control tumors (Figures 3F3H). Further examination of the CD4 compartment in CRISPR KrasG12D/+;Trp53RH/+shCXCL2 tumors revealed a significant increase in the CD4+Tbet+ Th1 population and a slight decrease in the CD4+Foxp3+ regulatory T cell population (Figures 3I and 3J). In contrast, no significant difference in neutrophil accumulation was detected in CRISPR KrasG12D/+; Trp53RH/+ tumors stably expressing shCXCL5 (Figure 3E). These results implicate tumor-cell-derived CXCL2 production in mediating the neutrophil immune phenotype of CRISPR KrasG12D/+;Trp53RH/+ tumors. Analysis of the peripheral blood of mice bearing orthotopic CRISPR KrasG12D/+;Trp53RH/+ tumors or KrasG12D/+;Trp53+/+ tumors revealed no significant difference in the abundance of neutrophils between flowjo dongle replacement fee Free Activators two tumor genotypes, ruling out a potential contribution of systemic neutrophilia (Figure S3F).
The combination of agonist CD40 immunotherapy with gemcitabine and nab-paclitaxel chemotherapy is currently in phase II clinical trials for treatment of pancreatic cancer. Treatment with a Glary undelete full crack antibody activates antigen-presenting cells (APCs) that can elicit an immune response from T cells using tumor antigens released by chemotherapy-mediated cell destruction (Byrne and Vonderheide, ). Because neutrophils may interfere with T cell proliferation and function as well as differentiation and maturation of APCs (Li et al., ; Schuster malwarebytes premium lifetime crack al., flowjo dongle replacement fee Free Activators, ), we hypothesized that neutrophils may cause resistance to CD40 combination dxtory 2.0 134 Free Activators. We treated mice bearing orthotopic CRISPR KrasG12D/+; Trp53+/+ tumors or CRISPR KrasG12D/+;Trp53RH/+ tumors with a single dose of gemcitabine and nab-paclitaxel, followed by one dose of mouse CD40 (FGK45) 48 h later, as established in prior publications (Byrne and Vonderheide, ). Tumors were harvested 4 weeks after the drug treatment (Figure S4A), flowjo dongle replacement fee Free Activators. CRISPR KrasG12D/+;Trp53RH/+tumors were more resistant to CD40 combination treatment than CRISPR KrasG12D/+;Trp53+/+ tumors, as measured by tumor weight (Figure S4B).
To determine whether neutrophils are a source of resistance to this drug flowjo dongle replacement fee Free Activators, we used a neutrophil depletion strategy in mice bearing CRISPR KrasG12D/+;Trp53RH/+ tumors. The anti-Ly6G antibody 1A8 is an established means for successfully depleting Ly6G+ cells in vivo (Boivin et al., ; Jamieson et al., ; Steele et al., ), and we confirmed the efficiency of intratumoral neutrophil depletion in our mouse model using flow cytometry (Figure S4C). CRISPR KrasG12D/+; Trp53RH/+ tumor-bearing mice were treated continuously with anti-Ly6G or control antibody every 48 h in addition to a single treatment of combination CD40 immunotherapy and gemcitabine and nab-paclitaxel chemotherapy commencing 2 weeks after orthotopic implantation (Figure 4A). CD40 combination treatment was more effective in slowing tumor growth when administered together with anti-Ly6G iris crack Crack Key For U with the control antibody combination (Figures 4B and 4C). Examination of intratumoral lymphocytes from CD40 combination immunotherapy/chemotherapy-treated tumors by flow cytometry 2 weeks after drug treatment revealed significant increases in CD3+, CD4+, and CD8+ cells in neutrophil-depleted mice compared with control mice (Figures 4D4F). Although there was no difference in PD1+CD8+ T cells, a marker of T cell exhaustion, or in CD4+Foxp3+ regulatory T cells (Figures S4D and S4E), we observed an increase in CD4+Tbet+ Th1 cells (Figure 4G) in tumors treated with CD40 combination immunotherapy and the Ly6G antibody in comparison with mice treated with combination immunotherapy and a control antibody. These results support a model where the gain-of-function Trp53RH mutation promotes neutrophil infiltration, which, in turn, could confer resistance to immunotherapy combination drug treatment.
Open in a separate window
Figure 4.
(A) Experimental design.
(B and C) Tumor growth curves (B) and waterfall plots (C) for 21 days after the start of the indicated therapy (n = 910 mice/group). Each symbol or bar represents the mean of a group (B) or a single mouse (C), respectively, with error bars indicating SEM. Statistical differences were determined by linear mixed-effects modeling with Tukeys honest significance (HSD) post-test (B) with significance indicated. **p ***p
(DG) Representative flow cytometry plots and quantification of (D) CD3+ T cells, (E) CD8+ T cells, (F) T helper cells, and (G) Th1 cells. Each dot represents one mouse; n = 89. Error bars, ± SD. Students t test (two-tailed, unpaired). *p flowjo dongle replacement fee Free Activators, **p ****p See also Figure S4.
Increasing evidence suggests that oncogenic drivers can coordinate with different secondary mutations to create diverse immune landscapes (Bezzi et al., ). Loss of p53 expression can cooperate with oncogenic KRAS to promote tumor development through the presence of CD11b+F+ macrophages (Blagih et al., ), and our work indicates a neutrophil-rich predominance when KRASG12D tumors acquire a gain-of-function p53 mutation, suggesting that shifts in the predominant myeloid population may occur based on secondary mutations. In non small cell lung cancer (NSCLC) mouse models, KRasG12D and MYC cooperate to induce CCL9-mediated recruitment of CD+ macrophages and PD-L1-dependent expulsion of T cells (Kortlever et al., ). Helicon Focus Crack contrast, STK11/LKB1 loss cooperates with KRasG12D to promote intratumoral accumulation of neutrophils in NSCLC (Koyama et al., ), indicating that secondary mutations may refine the composition of intratumoral immune populations and that different immune profiles may occur within the same cancer type. Although tumor genotype is not currently utilized for selecting individuals for immunotherapy, with the exception of those with high mutational burden being considered for treatment with PD1 therapy (Marabelle et al., ), our study adds to the mounting digital watercolor software that suggests that affected individuals may be stratified for clinical trials based on their genotype and/or immunophenotype to tailor precision therapy (Bezzi et al., ).
There are several possible mechanisms whereby p53 mutation might mediate an increase in ELR+ chemokines. Increased transcription of CXCL5 has been found to be dependent on gain-of function mutant p53 in multiple cancer cell lines, including lung, breast, and melanoma (Yeudall et al., ). In addition, there are several studies suggesting that the p53RH mutation may elevate CXC chemokine production through nuclear factor kB (NF-kB). Mutant Trp53RH is a well-established activator of NF-kB (Cooks et al., flowjo dongle replacement fee Free Activators, ; Weisz et al., ), and examination of the KPC mouse model revealed that NF-kB activation can potently increase CXCL5 levels (Chao et al., flowjo dongle replacement fee Free Activators, ). In addition, an analysis of the pancreatic cancer TCGA dataset demonstrated that tumors with high CXCR2 ligand expression were enriched significantly in expression of genes associated with inflammatory signaling pathways involving NF-kB (Chao et al., ). However, the mechanism by which p53 mutations can influence ELR+ chemokine expression may also depend flowjo dongle replacement fee Free Activators tumor tissue type. Most recently, flowjo dongle replacement fee Free Activators, a separate study examining Trp53RH mutant osteosarcoma cell lines demonstrated an increase in CXCL5-mediated by PLAC8 (ONZIN) overexpression (Zhang et al., ). PLAC8 is a small cysteine-rich protein that is strongly expressed in human invasive PDAC and is involved in pancreatic cell growth and progression, but its relationship to neutrophil chemokines has not been defined (Kaistha et al., ).
It has been proposed that neutrophils can be pro- or antitumorigenic depending in part on the specific cancer type and stage (Jaillon et al., ). Efforts have been made to classify neutrophils into anti-tumor (N1) neutrophils or pro-tumor (N2) neutrophils based on their activation status, cytokine production, and effects on tumor cells (Masucci et al., ; Fridlender et al., ). N1 neutrophils direct cytotoxic activity against tumor cells through production of hydrogen peroxide and nitric oxide, activate T cell-dependent adaptive immunity, and also limit bacterially driven inflammation (Dmitrieva-Posocco et al., ; Finisguerra et al., ; Fridlender et al., ). In contrast, N2 neutrophils can promote tumor cell proliferation by inhibiting T cell activation through release of reactive oxygen species flowjo dongle replacement fee Free Activators arginase 1 and also facilitate metastasis by assisting with formation of a pre-metastatic niche (Coffelt et al., ; Gabrilovich et al., ; Park et al., ). In the context of pancreatic cancer, neutrophil phenotypes are consistent with a pro-tumorigenic role. Human pancreatic cancer has abundant neutrophil infiltration (Chao et al., ; Reid et al., ), which is associated with poor prognosis (Wang et al., ). In addition, a high peripheral blood neutrophil-to-lymphocyte ratio is a negative predictor of overall survival and disease-free survival (Zhou et al., ). Neutrophil chemokines are correlated significantly with advanced clinical stage and shorter survival in human PDA (Li et al., ; Nywening et al., ). In our study, acquisition of neutrophils was associated with tumor growth and reduction of T cell accumulation, also suggestive of a pro-tumorigenic function. Two separate reports have explored the functional role of neutrophils in KPC mouse models of pancreatic cancer, primarily by modulating CXCR2 (Chao et al., ; Steele et al., ). Disrupting CXCR2 signaling prevented accumulation of neutrophils and induced T cell-dependent suppression of tumor growth in KPC tumors (Chao et al., ).
Because of the lack of response to single-agent immunotherapy in individuals with pancreatic cancer, combinatorial strategies are being actively explored in clinical trials (Siolas et al., ). Combination of the CD40 agonist antibody APXM and chemotherapy (with or without nivolumab PD1 therapy) showed an encouraging overall response rate of 54% in a phase Ib trial of individuals with metastatic pancreatic cancer and is currently under evaluation in an ongoing randomized phase II study (Vonderheide, ). Given that neutrophils suppress T cell proliferation and function, the ability to therapeutically target neutrophils is appealing and may open the door to improved efficacy of T cell-based therapeutics (Chao et al., ). There are two therapeutic agents targeting the CXCR2 chemokine axis currently in separate clinical trials, but neither has been explored with CD40 therapy (Bilusic et al., ; Evans, ). Our findings indicate that the gain-of-function mutant Trp53RH can cause accumulation of tumor-associated neutrophils, whose targeting may be used to augment the therapeutic efficacy of combination CD40 immunotherapy in pancreatic cancer. Furthermore, flowjo dongle replacement fee Free Activators, this contributes to the growing body of work showing that different tumor genotypes can have distinct immune profiles within pancreatic cancer, suggesting immunophenotype should be considered in therapy selection.
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Dafna Bar-Sagi (bilin.com.mxluyn@bilin.com.mx).
All unique/stable reagents generated in this study are available from the Lead Contact with a completed Materials Transfer Agreement.
This paper flowjo dongle replacement fee Free Activators existing, publicly available data. These accession numbers for the datasets are listed in the key resources table.
KEY RESOURCES TABLE
| REAGENT or RESOURCE Antibodies | SOURCE | IDENTIFIER |
|---|---|---|
| APC/Cy7 anti-mouse CD3 (17A2) | BioLegend | Cat# ; RRID:AB_ |
| BV CD45 (F11) | BioLegend | Cat# ; RRID:AB_ |
| PE anti-mouse F4/80 (BM8) | BioLegend | Cat# homeguard download RRID:AB_ |
| PE anti-mouse Foxp3 (FJK s) | Invitrogen | Cat# ; RRID:AB_ |
| APC/Cy7 anti-mouse CD11b (M1/70) | BioLegend | Cat# ; RRID:AB_ |
| PE anti-mouse CD80 (A1) | BioLegend | Cat# ; RRID:AB_ |
| PerCP/Cy anti-mouse CTLA4 (UCB9) | BioLegend | Cat# ; RRID:AB_ |
| APC/Cy7 anti-mouse MHCII I-A/I-E (M5/) | BioLegend | Cat# ; RRID:AB_ |
| PE anti-mouse Gr1 (RBC5) | BioLegend | Cat# ; RRID:AB_ |
| APC anti-mouse Ly6G (1A8) | BioLegend | Cat# ; RRID:AB_ |
| APC anti-mouse CD (CC2) | BioLegend | Cat# ; RRID:AB_ |
| Mouse BD Fc Block (G2) | BD pharmingen | Cat# ; RRID:AB_ |
| PE mouse anti-mouse T-Bet (4B10) | BD pharmingen | Cat# ; RRID:AB_ |
| APC anti-mouse CD4 (GK) | BioLegend | Cat# ; RRID:AB_ |
| PE/Cy7 CD8 () | BioLegend | Cat# ; RRID:AB_ |
| PerCP/Cy anti-mouse CD8 () | BioLegend | Cat# ; RRID:AB_ |
| PerCP/Cy anti-mouse CD86 (GL-1) | BioLegend | Cat# ; RRID:AB_ |
| PerCP/Cy Ep-CAM (G) | BioLegend | Cat# ; RRID:AB_ |
| PerCP/Cy anti-mouse PD1 (29F.1A12) | BioLegend | flowjo dongle replacement fee Free Activators ; RRID:AB_ |
| Pe/Cy7 anti-mouse IFN-g (XMG) | BioLegend | Cat# ; RRID:AB_ |
| PE anti-mouse CD31 () | BioLegend | Cat# ; RRID:AB_ |
| Pe/Cy7 anti-mouse PDGFRa (APA5) | BioLegend | Cat# ; RRID:AB_ |
| PE anti-mouse CD11c (N) | BioLegend | Cat# ; RRID:AB_ |
| PE IgG1k isotype control | Invitrogen | Cat# ; RRID:AB_ |
| Pe/Cy7 Rat IgG1 isotype control | BioLegend | Cat# ; RRID:AB_ |
| InVivo rat IgG2a mAb (2A3) isotype control | flowjo dongle replacement fee Free Activators rowspan="1" colspan="1">Cat# BE; RRID:AB_ | |
| InVivoMAb monoclonal anti-mouse Ly6G (1A8) | BioXCell | Cat# BE; RRID:AB_ |
| InVivoMAb CD40 rat anti-mouse IgG2a mAb (FGK45) | BioXCell | Cat# BE; RRID:AB_ |
| InVivoMAb anti-rat Kappa Immunoglobulin Light Chain | BioXCell | Cat# BE; RRID:AB_ |
| APC anti-mouse CD34 (HM34) | BioLegend | Cat #; RRID:AB_ |
| flowjo dongle replacement fee Free Activators antibody | Santa Cruz | Cat# sc; RRID:AB_ |
| Neutrophil Marker (NIMP-R14) antibody | Santa Cruz | Cat# sc; RRID:AB_ |
| P53 (1C12) Mouse antibody | Cell Signaling | Cat# S; RRID:AB_ |
| Anti-Vinculin mouse antibody | SigmaAldrich | Cat# V; RRID:AB_ |
| Bacterial and virus strains | ||
| STBL3 | ThermoFisher | Cat# C |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Nab-paclitaxel | Celgene | Cat# |
| Gemcitabine | Hospira | Cat# |
| Albumin | Sigma Aldrich | Cat# A |
| Xtremegene 9 | Roche | Cat# 06 |
| Polybrene | Sigma Aldrich | Cat# TRG |
| Hygromycin | Sigma Aldrich | Cat# |
| G | Sigma Aldrich | Cat# |
| PfIFI | New England Biolabs | Cat# RS |
| BsmBI | New England Biolabs | Cat#RS |
| flowjo dongle replacement fee Free Activators rowspan="1" colspan="1">Cheminpharma | Cat# S | |
| Lipofectamine | Life Technologies | Cat# L |
| Critical commercial assays | ||
| Surveyor DNA mutation Kit | IDT | Cat# |
| TOPO TA Cloning Kit | Thermo-Fisher | Cat# KJ10 |
| SYBR Green PCR Master Mix | Thermo-Fisher | Cat# |
| Quantitect Reverse Transcription Kit | QIAGEN | Cat# |
| Zombie Green Fixable Viability Kit | Biolegend | Cat# |
| RNeasy Mini Kit | QIAGEN | Cat# |
| Milliplex Mouse Cytokine Magnetic Bead Panel | Millipore Sigma | Cat# MCYTOMAGK |
| KAPA Mouse Genotyping Kit | Roche | Cat# |
| Foxp3/Transcription Factor Staining Buffer Set | Invitrogen | Cat# |
| Experimental models: Cell lines | ||
| HEKT | ATCC | Cat# ATCC® CRL |
| KrasG12D/+;Trp53+/+PDEC | Pylayeva-Gupta et al., | N/A |
| KrasG12D/+;Trp53/ PDEC | This manuscript | N/A |
| KrasG12D/+;Trp53RH/+PDEC | This manuscript | N/A |
| Experimental models: Organisms/strains | ||
| C57Bl6/J mice females (weeks) | Charles River Laboratories | CR: |
| Oligonucleotides | ||
| p53 sgRNA, CGG AGC AGC GCT CAT GGT GG | This manuscript | N/A |
| p53 HDR template, CAC CTC CAG CTG GGA GCC GTG TCC GCG CCA TGG CCA TCT ACA AGA AGT CAC AGC ACA TGA CGG AAG TCG TGA GAC ACT GTC CCC ACC ATG AGC GCT GCT CCG ATG GTG ATG GTA AGC CCT CAA CAC CGC CTG TGG GGT TAG GAC TGG CAG | This manuscript | N/A |
| p53 Forward PCR primer, TGGGA CAGCCAAGTCTGTTA | This manuscript | N/A |
| p53 Reverse PCR primer CCTGCT GTCTCCAGACTCCT | This manuscript | N/A |
| shScramble CCGGTCCTAAGGTTA AGTCGCCCTCGCTCGAGCGAGGG CGACTTAACCTTAGGTTTT | Sarbassov et al., | Addgene Cat # |
| CXCL2 forward PCR primer ATGC CTGAAGACCCTGCCAAG | Roy et al., | N/A |
| CXCL2 reverse PCR primer GGTC AGTTAGCCTTGCCTTTG | Roy et al., | N/A |
| CXCL5 forward PCR primer ACAGT GCCCTACGGTGGAAGT | Roy et al., | N/A |
| CXCL5 reverse PCR primer CGAGT GCATTCCGCTTAGCTT | Roy et al., | N/A |
| Recombinant DNA | ||
| pLKO.1 neo | Gift from Sheila Stewart | Addgene Cat# |
| psPAX2 | Gift from Didier Trono | Addgene Cat# |
| pMD2G | Gift from Didier Trono | Addgene Cat# |
| pLKO.1 hygro | Gift from Bob Weinberg | Addgene Cat# |
| LentiCRISPRv2 hygro | Stringer et al., | Addgene Cat# |
| conditional EMCO MSI Package Builder 7.3.5 Crack 2019 Crack Key For U rowspan="1" colspan="1">Gift from R. Sordella, Cold Spring Harbor Laboratory | N/A | |
| Software and algorithms | ||
| ImageJ | Schneider et al., | bilin.com.mx; RRID:SCR_ |
| FlowJo version | FlowJo | bilin.com.mx; RRID:SCR_ |
| R version | RStudio | bilin.com.mx; RRID:SCR_ |
| Prism Version 7 | GraphPad | bilin.com.mx; RRID:SCR_ |
| Vevo Lab | FUJIFILM-VisualSonics | bilin.com.mx |
| Other | ||
| Whole-Tissue Gene Expression Data of Pancreatic Ductal Adenocarcinoma | Badea et al., | GSE |
| Expression data from Mayo Clinic Pancreatic Tumor and Normal samples | Pei et al., | GSE |
Open in a separate window
All data reported in this paper will be shared by the lead contact upon request.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
The LSL-KrasG12D/+;Trp53+/+;p48Cre/+ and LSL-KrasG12D/+;Trp53LSL-RH/+;p48Cre/+ mouse strains were previously described (Pylayeva-Gupta et al., ). The Institutional Animal Care and Use Committee at the New York University (NYU) School of Medicine approved all animal care and procedures. All mice were housed under conditions in line with NYU Institutional Animal Care and Use Committee guidelines. Mice were housed from 35 per cage and were kept in a h day/night cycle with light from until For orthotopic mouse models, 7to 9-week-old wild-type (WT) C57BL/6 (stock ) mice were purchased from The Charles River Laboratories. All mice were from a C57BL/6 flowjo dongle replacement fee Free Activators background. Female mice were used for orthotopic injections of CRISPR KrasG12D/+;Trp53RH/+ PDEC, KrasG12D/+;Trp53/ PDEC, and KrasG12D/+;Trp53+/+ PDEC cell lines using the method described flowjo dongle replacement fee Free Activators Das et al. (). For chemotherapy treatment, gemcitabine, pharmaceutical grade suspension at 38 mg/ml, was diluted to 12 mg/ml in PBS and administered at mg/kg via kaspersky internet security 2018 crack Crack Key For U (i.p.) injection (Byrne and Vonderheide, ). Nab-paclitaxel (Abraxane, Celgene) pharmaceutical grade powder was resuspended at 12 mg/ml in PBS and administered at mg/kg i.p., or an equivalent molar dose of human albumin (Sigma) was administered i.p. as control (Byrne and Vonderheide, ). Mice were injected on day 14 after orthotopic implantation. Chemotherapy was purchased through the NYU Langone Health pharmacy. Mice received ¼g of either agonist CD40 rat anti-mouse IgG2a mAb (clone FGK45, endotoxin-free) or the isotype control IgG2a mAb (clone 2A3) on day 16 after orthotopic surgery. Neutrophils were depleted by i.p. injection of ¼g Ly6G+ Ab (clone 1A8) and ¼g mouse IgG2a anti-rat antibody (clone Mar ) or isotype control mAb (clone 2A3) on day 12, repeated every 48 h. All antibodies were purchased from BioXCell. Mice were euthanized by carbon-dioxide-induced narcosis for flow cytometry analysis and tumor size assessment.
Isolation, culture, flowjo dongle replacement fee Free Activators, and adenoviral infection of pancreatic ductal epithelial cells (PDECs) was carried out as previously described (Pylayeva-Gupta et al., ). CRISPR-generated cell lines are described in the detailed Methods. HEKT cells were purchased from the ATCC and maintained in DMEM with 10% FBS and penicillin-streptomycin at 37°C. Scramble control shRNA (Sarbassov et al., ) and shRNAs against CXCL2 and CXCL5 were cloned into the lentiviral pLKO.1 neo (gift from Sheila Stewart) and pLKO.1 hygro (gift from Bob Weinberg) vectors, respectively, obtained from Addgene. Lentiviral particles were generated by transfecting HEKT cells using Xtremegene 9 with the pLKO.1 vector, the packaging construct (psPAX2, gift from Didier Trono), and the envelope plasmid (pMD2G, gift from Didier Trono). Supernatants containing viral particles were collected over a period of 48 h and stored at 4°C. Following final collection, supernatants were filtered through a ¼m-pore-size syringe filter and concentrated using MWCO Amicon Ultra centrifugal filters (Millipore). A multiplicity of infection (MOI) of 10 was used for lentiviral infection of PDEC cells in the presence of 10 ¼g/ml Polybrene (Chemicon), and infected cells were selected using ¼g/ml hygromycin (Sigma) or ¼g/ml G (Sigma). All data representative of 3 independent clones from 3 independent experiments
A sgRNA was designed to target the desired Trp53 mutation using CRISPR Design. The sgRNA sequence 5-CGG AGC GCT CAT GGT GG-3 was cloned into LentiCRISPRv2 (Stringer et al., ) from Addgene according to a published method (Sanjana et al., ) and infected into PDEC cells as described above, flowjo dongle replacement fee Free Activators. sgRNA efficiency was verified via a Surveyor nuclease assay as described (Senturk et al., ). sgRNA was also cloned into the conditional EDCPV vector (gift from R. Sordella) as detailed in Senturk et al. (). Virus packaging was achieved by transiently co-transfecting HEKT cells in cm culture dish with 3 ¼g of the p53sgRNAEDCPV, 6 ¼g of the packaging plasmid psPAX2, and 3 ¼g of the envelope plasmid pMD2.G (Addgene) using 30 ¼l of Lipofectamine reagent (Life Technologies). Viral particles of 10 ml were collected after 48 h of transfection by clarifying the supernatant through ¼m filter membrane (GE Healthcare). Virus transduction was optimized in order to achieve low-MOI transduction. A single-strand DNA homology-directed repair (HDR) template was created with sequence 5-CAC CTC CAG CTG GGA GCC GTG TCC GCG CCA TGG CCA TCT ACA AGA AGT CAC AGC ACA TGA CGG AAG TCG TGA GAC ACT GTC CCC ACC ATG AGC GCT CCG ATG GTG ATG GTA AGC CCT CAA CAC CGC CTG TGG GGT TAG GAC TGG CAG-3. A silent mutation (G A) was placed in the 5 protospacer adjacent motif (PAM) region and another silent mutation was designed for the 3 PAM region (C T) adjacent to the target to prevent multiple recombination events. This resulted in the creation of a unique restriction enzyme cloning site, PflFI (New England Biolabs), which would appear in target cells upon successful HDR, in conjunction with loss of the BsmBI restriction enzyme site (New England Biolabs). A cm dish of PDEC cells was transfected with single-strand DNA HDR template using 25 ¼L of Lipofectamine (Life Technologies). Shield-1, obtained from Cheminpharma, was solubilized flowjo dongle replacement fee Free Activators pure ethanol and added to the culture medium at a concentration of nM (final), and the cells were cultured for 24 h. After 24 h, Venus-positive single cells were sorted into five well plates using a BD FACS ARIA II sorter at the NYU Cytometry and Cell Sorting Facility and allowed to grow for 10 free pro Activators Patch. Genomic DNA was extracted and amplified as per manufacturers directions using KAPA Hot Start Genotyping kit (Sigma) and the primers 5-TGG GAC AGC CAA GTC TGT TA-3 and 5-TAA GGA TAG GTC GGC GGT TC-3. Restriction enzyme digestion was performed separately for BsmBI and PflFI to screen for successful HDR. Clones that were not digested by BsmBI, but were successfully digested by PflFI, were sent to Genewiz for Sanger sequencing. To determine heterozygosity, genomic DNA was amplified using the primers above and Phusion High-Fidelity DNA Polymerase (New England Biolabs). Amplicons were cloned using a TOPO TA Cloning Kit (Thermo Fisher) as per manufacturers instructions and transformed into STBL3 chemically competent cells. Twenty bacterial colonies containing plasmids were selected for DNA isolation and PCR. PCR products were used for direct Sanger sequencing (Genewiz). In addition, all CRISPR KrasG12D/+;Trp53RH/+ and KrasG12D/+;Trp53+/+ PDEC cell lines used in this paper were analyzed by RNA sequencing. RNA was isolated using an RNeasy kit (QIAGEN) and genomic DNA was removed using an RNase-free DNase kit (QIAGEN), flowjo dongle replacement fee Free Activators. RNA sequencing was performed by NYU Langones Genome Technology Center using an Illumina HiSeq instrument. Three cell lines were created for each genotype. KrasG12D/+;Trp53+/+ cell lines were infected and single cell sorted as above, but were not treated with Shield-1 and therefore did not undergo DNA editing. KrasG12D/+;Trp53/ PDEC cell lines were generated by treating with Shield-1 as above, but without the addition of a HDR template.
Single-cell suspensions were prepared from pancreata as described (Pylayeva-Gupta et al., ), and tumor-infiltrating lymphocytes were isolated as described (Das et al., ). All samples were acquired on an LSR II instrument (BD Bioscience) at the NYU Cytometry and Cell Sorting Facility and analyzed with FlowJo version (TreeStar, Inc.). Cell sorting using a BD FACS ARIA II sorter was performed to isolate Ep-CAM+ cells and CD45+ cells, and flowjo dongle replacement fee Free Activators purity of sorted cells was achieved. All data representative of 3 independent clones from 3 independent experiments
Mouse pancreata were fixed overnight in 10% buffered formalin (Fisher Scientific) and embedded in paraffin as described earlier (Pylayeva-Gupta et al., ). For histology analysis, flowjo dongle replacement fee Free Activators tumors were processed for routine hematoxylin and eosin staining. For immunehistochemistry, methods were as in (Das et al., ), with rat anti-Ly6G (, Santa Cruz) used as the primary antibody. Slides were examined on a Nikon Eclipse 80i microscope. Immunofluorescence staining using Ki or MPO, along with CK19, was performed at the NYU Experimental Pathology Research Laboratory. Scoring of tumor sections for individual markers was performed by counting 10 fields using Omero imaging software and images were analyzed to measure stained area using ImageJ software (Schneider et al., ).
For assessment of cell cycle genes, cultured PDEC cells were treated with ¼M of doxorubicin for 36 hr and then subjected to RNA extraction with a RNeasy Kit (QIAGEN) as per the manufacturers instructions. Total RNA (1 ¼g) was reverse-transcribed using the Quantitect Reverse Transcription Kit (QIAGEN). Subsequently, specific transcripts were amplified with SYBR Green PCR Master Mix (USB) using a Stratagene Mx P thermocycler. Primer sequences for Cxcl2 and Cxcl5 are in key resources table (Roy et al., ). Where fold expression is specified, the comparative CT method flowjo dongle replacement fee Free Activators used to quantify gene expression, flowjo dongle replacement fee Free Activators. Expression was normalized to that of GAPDH. For RNA isolation from tumors, pancreata processed to single-cell suspension were stained for flow cytometry. CD45CD34PDGFRaEp-CAM+ cells or CD45+ immune cells were FACS sorted using a ¼m nozzle into the lysing reagent RLT, and total RNA was extracted as per the manufacturers instructions (RNeasy Mini Kit, QIAGEN). To check knockdown in PDEC cells, 105 cells were lysed in ¼L RLT reagent and total RNA was extracted as per the manufacturers instructions (RNeasy Mini Kit, QIAGEN). QPCR was performed as described above.
human PDAC tumor (n = 75) and Adj Norm (n = 55) mRNA expression profiles generated on the same array (Affymetrix GeneChip Human Genome U Plus ) were downloaded from GEO (GEO: GSE (Badea et al., ), GSE (Pei et al., )) and processed as previously described (Gadaleta et al., flowjo dongle replacement fee Free Activators. CXCL cytokines plots and an unpaired Students t test were generated in GraphPad Prism (GraphPad Software, CA, USA; bilin.com.mx). TCGA data (Pancreatic Adenocarcinoma, TCGA Firehose Legacy) were analyzed in cBioPortal (bilin.com.mx). PDAC tumors with very low tumor cell content ( 33%) or labeled as non-PDAC, were removed and n = 58 tumors with hotspot missense mutations in TP53 DNA binding domain and n = 63 tumors without mutations or homozygous deletions were compared using cBioPortals Groups analysis function. Genes with significantly higher expression (q value ) in p53 mutated versus WT tumors were imported into Enrichr (bilin.com.mx), and assessed for enrichment in Gene Ontology Biological Process gene sets.
Image acquisition and analysis were performed at the NYU Preclinical Imaging Laboratory. Mice were anesthetized with 2% isoflurane and placed on a physiological stage CAD Crack All Windows/Mac OS Software Full Version to a Vevo (Visualsonics, Fujifilm) high frequency ultrasound scanner, flowjo dongle replacement fee Free Activators. The stage monitored the mouses core temperature, respiration rate and heart rate, flowjo dongle replacement fee Free Activators. The abdominal area was wet shaved, ultrasound gel applied and an MXDD transducer lowered until a transverse section of the tumor was centered in the field of view. The transducer was connected to a stepper motor and a 3D volume was acquired using a micron slice spacing. The volumetric data was then imported to the Vevo LAB (Visualsonics, Fujifilm) analysis software. The tumor was segmented by drawing contours around the periphery of the tumor for each slice and the volume calculated by the volume measurement tool.
Cultured PDEC cells were treated with ¼M of doxorubicin for 24 hr. Cells were lysed in sample buffer, denatured at 95°C, and resolved on polyacrylamide gels. Cells were probed for p53 with monoclonal anti-mouse p53 antibody. Vinculin was detected as a loading control. Secondary antibodies were purchased from LiCOR IRDye CW and CW.
Orthotopic tumors were minced with a razor blade and incubated in RPMI media flowjo dongle replacement fee Free Activators one hour at 37°C. The solution was centrifuged for 2 min at RPM in a microcentrifuge. The supernatant was then assayed according to the manufacturers instructions using a MILLIPLEX Mouse Cytokine/Chemokine Magnetic Bead Panel, in a Luminex (Luminex Corporation, Austin, TX, USA) machine.
At least 5 mice were included in each group, unless noted and the experiments were repeated a minimum 2 times. Group means were compared with Student t tests. Significance of variations between two groups was determined by an unpaired Student t test (two-tailed). Statistical analyses were performed using GraphPad Prism software (version d), and data are presented as mean ± SD p was considered statistically significant. Statistical details and p values of experiments can be found in the corresponding figure legends.
Gain-of-function Trp53RH promotes neutrophil recruitment to pancreatic tumors
Neutrophils in KrasG12D/+;Trp53RH/+ tumors are due to tumor-cell-derived flowjo dongle replacement fee Free Activators confer resistance to CD40 combination immunotherapy and chemotherapy
We thank L.J. Taylor for help with manuscript preparation. We thank the NYU Cytometry and Cell Sorting Laboratory Facility, Preclinical Imaging Laboratory, and Experimental Pathology Research Laboratory, which are partially supported by Perlmutter Cancer Center grant P30CA and NIBIB grant NIH P41 EB This work was funded by NIH/NCI CA (to D.B.S.) and by the Lustgarten Foundation Pancreatic Cancer Dream Team (SU2C-AACR-DT to D.B.-S.). D.S. is supported by NIH K08CA E.A.V. was supported by a Canadian Institutes of Health research fellowship (). E.K. was supported by NIH F30 CA The graphical abstract was created with BioRender.
Dongle ID Mac
1. Open Mac apple icon
2. Open ‘About This Mac’
3. Click on ‘System Report’
4. Under ‘Hardware’, click on USB
5. Under USB HighSpeed Bus, click on USB Disk
6. Look for ‘Serial Number’. This is the dongle ID
Mac Lion
1. Open Mac Apple Icon
2. Open “About this Mac”
2. Click “more info”
3. Click on the Storage tab, then click on Disk Utility
4. Click on “USB”
5. Then click “Serial ID”
Vista
1. Double-click the icon in the lower-right task bar that says “safely remove hardware”
2. Click on “Properties”, then ”Details”
3. Select “Device Instance Path” from the drop-down list
4. The dongle ID will appear as the last part of a line, everything after the slash mark (“\”)
Windows 7
1. Navigate to Computer, then click on the dongle drive
2. Right-click for Properties, then click “Hardware”
3. Select flash drive, then “Properties”
4. Choose “Details”, then “Choose Device Instance Path”
5. The serial ID is everything after the last slash mark (“\”)
Windows 8
1. Click “Desktop View”, then “file Explorer”
2. Right-click for Properties, then click “Hardware”
3. Select flash drive, then “Properties”
4. Choose “Details”, then “Choose Device Instance Path”
5. The serial ID is everything after the last slash mark (“\”)
Windows XP
1. Right-click on My Computer, then click “Properties”
2. Click the “Hardware” tab, then “Device Manager”
3. Under Disk Drive, find the find the USB drive and double-click on it
4. Click on the “Details” tab
5. Make sure that “Device Instance” is chosen, flowjo dongle replacement fee Free Activators.
6. The Serial ID for the dongle will appear after the slash mark (“\”)
#Flowjo cracked for mac#
Team EvilSevil Software: FlowJo v PC and MAC Nokia Siemens will show off new features for its Liquid Radio Software Suites.ĭownload for PC Download for Mac Download for Linux. Best Cracker Website Request CrackPrivate Crack,business Much Money Program and etc. Layout Charting, Editing, and Iteration have all received passes improving perfomance and aesthetics. Crack Patch Serial Keygen Key freeload Cracked Full Version. Disqus - Flowjo 10 Serial Number Crack Many downloads like Flowjo may also include a crack, serial number, unlock code or keygen key generator.
#Flowjo cracked how to#
This page only contains detailed info on how to uninstall FlowJo supposing you decide this is what you want to do. The application provides you with the means to customize each band with the preferred tasks that you commonly use. For example: concatenate clinical specimens, and then gate on all data from only control subjects, or only female subjects, or any other criteria. FlowJo software is used flowjo windows cracked the analysis of flow cytometry data. FlowJo is the world-leading data analysis software for flow cytometry. The Southwest Riders Description: Southwest Riders is a compilation presented by rappers B-Legit and E Southwest riders compilation rar files download. Technitium MAC Address Changer is a free tool that can change your Media Access Control (MAC) address. We distribute pre-built binary versions for various architectures. Download: PRISM should run on 32/bit versions of all major operating systems. FlowJo® is the leading analysis platform for single-cell flow cytometry analysis. Flowjo V Mac Cracked Rare axayomypo Disqus. In free image graphics lake can download by Megaupload. freeload Flowjo Cracked Mac.įlowJo v PC and MAC cracked version bilin.com.mx 10 mac serial Full. Welcome to FlowJoa software application with an integrated environment for viewing and analyzing flow cytometric data. WindowsLinuxMacAndroidiphone applicationebookgame supplies, contact us if u Jul 18, ➡ Link: Flowjo windows cracked PC Dynasty Warriors 7 Xtreme Legends Crack magnet-link cloud, Size:
#Flowjo cracked
0 notes
Flowjo cracked version
#FLOWJO CRACKED VERSION FOR FREE#
#FLOWJO CRACKED VERSION FOR FREE#
You can download and install Windows for free even if you are using a Mac. level 1 2 points 1 year ago Send out some emails and ask around if there is a lab either at your institution or a nearby institution that has a license, so you can go over to that lab and do your analysis there. level 2 Original Poster 1 point 1 year ago Cracked softwares for FlowJo exist, that I know for sure.Īlthough I appreciate the concern for using a cracked software, I am aware of the risk, but doesnt really help me with my question. If you have a flow core, they might have flowjo on a communal computer.īut really, your PI should just invest in a dongle, instead of making it hard for students to do their work.Įven if it does, using cracked software is something that can get you, your PI, and your institution fined LOTS of money. Unsure how true this is, but people say to be off-line when working off crack flowjo. I was also told that flowjo knows when a cracked copy is opened. In other words, people are less likely to be able to open your analysis files on another computer, so you need to do all your analysis in full and print everything out. One thing to consider is that the conversion between versions is not supported by crack. Flowjo 10 Torrent Cracked Versions ExistĬontinue this thread level 1 6 points 1 year ago Cracked versions exist for PC. Upvoted This thread is archived New comments cannot be posted and votes cannot be cast Sort by best level 1 8 points 1 year ago If your PI refuses to cough up 2K, you should refuse to cough up results. My flow analysis, and subsequently my Masters thesis, depends on this. Was wondering if anyone could help me out and send me such a file or instruct me on how to go about doing this. Flowjo 10 Torrent Cracked Versions Exist.
#Flowjo cracked version
0 notes
Flowjo cracked
Flowjo cracked serial key#
Flowjo cracked serial number#
Generally, scales to larger contributions for better updates.Īll of us have this basic need for analysis.
Flowjo cracked serial number#
FlowJo serial number free Getting straight to the point is its own essential nature for beginners.A powerful instrument works flawlessly on Windows and MAC as bilin.com.mx another task for a natural treble bilin.com.mx your new thoughts as you need with your help to increase your level of bilin.com.mxng new instruments for skeptical questions and bilin.com.mx are a large number of FCS documents that acknowledge their long-term bilin.com.mx application is useful only an instinctive situation to drag and drop bilin.com.mx work with permission to run your bilin.com.mx brilliant program for an innovative exam inside or outside the bilin.com.mx best demo programming for information bilin.com.mxy to progressively view essential data about a meeting and its bilin.com.mxc compensation, simpler to read and bilin.com.mxe, German, French, Japanese, and Spanish are fully bilin.com.mx download process for this tool is also straightforward. You can also download this tool from our secure link. FlowJo License Code can Measurement scales are often logarithmic with excessive precision. This method has many programs for testing health problems, especially most cancers. It can analyze data on laptop routinely, which makes it easy for researchers to draw three-dimensional diagrams. The software can be used for every study and clinical purpose and features beneficial tools and competencies in each field. There are many other great features of this tool. The layout of the main window not only allows you to explore the basic functions of FlowJo mac Crack. The entire analysis process is also carried out in a very short period of time. In the latest version, programs have been developed for the decomposition and visualization of information about flows.
Flowjo cracked serial key#
Flowjo crack torrent serial key#įlowJo Serial Key this program can be used for both clinical and research purposes. The user of this tool is available worldwide. It also provides you with drag and drop functionality. Flowjo crack torrent serial number#įlowJo Serial Number generator is a pioneer in the discoveries, in fact through curiosity, the style of statistical bilin.com.mx are also billions of users of this tool. Also, movable type is an important aspect for you where you can check plugins for that. Also, you are collaborating on the effects you need and then it is platform dependent. You don’t need to worry about building lab data. You can download Flowjo from the link provided.īecause has a new trend for smart bilin.com.mx you think the generator is more PayPal then you are a fool. The latest version developed programming to drill down and display broadcast information.
#Flowjo cracked
0 notes
Flowjo serial number free crack
#FLOWJO SERIAL NUMBER FREE CRACK HOW TO#
#FLOWJO SERIAL NUMBER FREE CRACK SERIAL KEY#
#FLOWJO SERIAL NUMBER FREE CRACK FULL#
#FLOWJO SERIAL NUMBER FREE CRACK SOFTWARE#
Additionally, the cell sort is a major thing for you where you can check modules for that. it will trailblaze the disclosures, basically by interest style of information portrayal. FlowJo has another pattern to make brilliant tasks.įlowJo Keygen is presently presenting you with an online hotspot for the formation of turn consuming. You have no compelling reason to stress for the lab information development. Also, it is working together with the impacts you need and afterward relies on the stage. Thus, it is famous for sorting out the information for ventures. For the conveyance of new ways, you can see more stuff in the wake of extricating the understanding of cell examination and afterward great nature of articulation you have for datasets, and so forth. FlowJo Torrent can investigate the standard information for inquiring about. This current program’s installer will lead you a lot for stream cytometry. This is a propelled sort of programming that works best for the following degree of research and afterward gives you the best outcome as each cell in turn. Here, you can get progressively the opportunity to quicken phenotype and immunology look into.
#FLOWJO SERIAL NUMBER FREE CRACK FULL#
FlowJo endeavors your information with an exceptional wellspring of your information with full help. It makes new documents in the cytometry standard structure. If you begin with a sequential number along with your laboratory expands with computers you can convert a sequential number to a dongle to get a Flowjo Complete bilin.com.mx License Keys is a swiss armed force blade of investigating programming for cytometry information. Additionally, FlowJo Keygen employ a range of innovative tools that will process creating subsets until the collection is composed FlowJo Crack With Maximum Number.
#FLOWJO SERIAL NUMBER FREE CRACK HOW TO#
FlowJo Serial Number allows you to know how to determine the attention of a solution by titration. Flowjo Free Trialįor every sample, it is possible to do various forms of tasks like adding keywords or data, display data collections at a spatial spin capable fix window and join documents together. You might also change group preferences, include title, color, font design, function, sample inclusion average, and assignments. Additionally, there’s arrange samples in Group part where you would like to examine them. FlowJo Crack possess a user-friendly interface and also exist on the primary workspace and several ribbons which contain tabbed groups which permit you to scroll through numerous rings to get different jobs.
#FLOWJO SERIAL NUMBER FREE CRACK SERIAL KEY#
Software freeload Torrentįaculty Core Facility LKS Faculty of Medicine Version 1 FlowJo Standard Operation Protocol Basic Operation Launching FlowJo analysis software.įlowJo Crack Incl Serial Key Latest Version Download The FlowJo Crack is a powerful program that eases you an environment for analyzing and displaying the flow of information. It performs comprehensive analyses of up to thousands of samples containing millions of events in a high dimension event space. FlowJo is a scientific analysis program designed for flow cytometric data. FlowJo Crack With Keygen freeload-The FlowJo Crack is an intense application that encourage you a situation for showing and dissecting stream of bilin.com.mxrmore, there is sort out examples in Group segment in which you need to investigate them. FlowJo Crack With Keygen freeload. In addition to gating and statistics, FlowJo has specialized analysis platforms for assays involving DNA/Cell Cycle, Kinetics, and Proliferation, among others. FlowJo's strength is in analyzing whole experiments encompassing many related samples.
#FLOWJO SERIAL NUMBER FREE CRACK SOFTWARE#
FlowJo is a software application with an integrated environment for viewing and analyzing flow cytometric data.
#Flowjo serial number free crack
0 notes
Flowjo cracked version
#Flowjo cracked version cracked
Upgrades do not qualify for dongle trade-in credit towards a FlowJo Portal license.
#Flowjo cracked version cracked
If you wish to turn in your dongle towards FlowJo Portal credit, we will use the original purchase date of your dongle. Flowjo Cracked Version Of 23 ((TOP)) Download Flowjo Cracked Version Of 23 flowjo x 32 winamp What is Tree Star FlowJo What is FlowJo You can also check below here: ctrl + f Tree Star FlowJo X R2 Linux Tree bilin.com.mx also offer physical upgrade and replacement which includes a shipping fee. If your dongle is in good working condition, we can upgrade it bilin.com.mx you are unsure of which version your dongle allows access to, call or email for license bilin.com.mxe to v10 with your existing dongle: Contact Sales Upgrade to a FlowJo Portal license: Contact Sales or click here for more info. Your serial number will transfer and automatically authenticate all versions of v9 and v Nicole Pope on flowjo cracked version of Serial Number: Download and install the latest version of FlowJo v The update bilin.com.mx X is a next generation data analysis and visualization platform for single cell analysis of cytometry data. FlowJo v Minor update to FlowJo v Your dongle will automatically authenticate all versions of v9 and v Free Trial FlowJo License Upgrade with FlowJo X. Upgrading from v9ĭongle: Download and install the latest version of FlowJo v Your serial number will transfer and automatically authenticate all versions of v The main Window design not only allows you to explore the essential. Your dongle will automatically authenticate all versions of v A FLOWJO serial number is required to activate the full version of Flowjo Crack. FlowJo Portal license: Updating to the latest version of FlowJo for FlowJo Portal license holders is easy! Simply download the latest version of FlowJo v10 above and sign in with your FlowJo Portal ID.ĭongle: Download and install the latest version of FlowJo v
#Flowjo cracked version
0 notes
Flowjo mac crack
Flowjo mac crack full version#
If you have a portal account, choose “Use you FlowJo Portal account”. Next, if you have a dongle (a physical thumb drive that has a license key on it) plugged into your computer, FlowJo will detect it automatically and allow you to click “Done” to authenticate. First, click on the checkbox to accept the license terms. When FlowJo is launched for the first time, the FlowJo license information window will open with the licensing agreement and license options.
We encourage you to update to the most recent version of FlowJo.
To obtain a trial day serial number so that you may try FlowJo with your data please fill out the form on our day trial serial number page. For more information on obtaining a FlowJo license, please see our license options page or submit a request for a quote. However, until a portal license, serial number or dongle is provided, FlowJo will only load specially enabled demonstration data files.
Flowjo mac crack full version#
You have downloaded the full version of FlowJo. For more information on installation please see our pages describing installation from the web. Once the zip file is extracted, double-click on the icon to launch FlowJo. zip file and double-click it to extract the program. Choose to place a shortcut on the desktop, and when the installer finishes, double-click on the FlowJo shortcut icon to launch the program. exe file and open it to install the program. You can select your platform (Mac or PC) at the top of the page. Getting Started and FlowJo Licensing Informationįirst, you need to install FlowJo by downloading the installer from our website. If you have already installed FlowJo, you may skip to the Initial Launch, License Information, and License sections of this document below.
#Flowjo mac crack
0 notes
Flowjo Crack + Serial Number () Torrent Free Download
Flowjo Crack + Serial Number () Torrent Free Download
Flowjo Crack is a swiss army knife analyzing software program for cytometry data. Moreover, Flowjo creates the latest files in the cytometry standard form, etc. FlowJo Endeavor for your data with an excellent source of your data with full support. Add more, with this you can get more chances to quicken phenotype and immunology research. Furthermore, it is a modern type of application that works best for the next level of research and then gives you a good result in the form of one cell at a time.
Furthermore, the FlowJo Torrent is user-friendly and consists of the main workspace and many different ribbons that contain tabbed bands that permit you to scroll through various bands to access different tasks, etc. Moreover, this amazing software gives you the means to customize each band with the preferred tasks that you usually use. However, by using this tool you can also drag and drop samples or bands on the workspace.
Flowjo With Crack + Torrent [Mac] Download…
Moreover, the FlowJo Crack also can Measurement scales are typically logarithmic with Inordinate precision, etc. however, this method contains many programs within the have a look at health problems, especially most cancers. All in all, the Flowjo mac crack download has the ability to analyze the data on a laptop routinely makes it best for researchers to draw three-dimensional diagrams, etc. add more, the app may be used for each study and clinical purpose and presents good tools and competencies in each field.
All in all, the FlowJo Torrent Free Download trailblaze the new discoveries, indeed through curiosity, style of statistics representation, and much more. And, also the mobile kind is an important aspect for you in which you could check plugins for that. By using this tool you can create new projects daily. Likewise, it is collaborating on the effects you want and then depends upon the platform. However, you don’t need to worry about the lab data construction. Add more, FlowJo has a new trend to create smart projects. you can also download Flowjo mac crack from our site. However, If you think Flowjo serial number generator is more PayPal then don’t worry about it. Here we are providing it totally free. So, visit my site and enjoy Flowjo download cracked.
Key Features:
Furthermore, it is ideal for every kind of user.
It is very fast even you have an original version.
Add more you can also work in free to run your MAC.
Further, it is a perfect memory management system.
More, the frank is its own basic nature to beginners.
It has the ability to makes a new project for biological smart trends.
Also, has new instruments for agnostic problems and platforms.
Add more, one can create files in the cytometer standard format with its help.
Furthermore, scales up you to larger inputs for better improvements.
Moreover, a comprehensive tool works perfectly over Windows & Mac.
More, there are too many FCS files which it accepts for long-time accessibility.
Further, it’s a smart program for trailblazing analysis in or outside the lab.
Add more, Get your new ideas as you want with its help to grow up your research level.
Furthermore, the software is useful only in an advanced environment for the drag-drop feature.
Moreover, a single solution for flow analysis with a compatible view from one file to another, etc.
Likewise, it’s the Best modeling software for data analysis
What’s NEW:
Drag and drop analysis intuitively
Also, has advanced models for advanced data analysis
Furthermore, Publication-quality graphics
All in all, the Plug-in architecture with unique updates
System Requirements:
An Intel Core i7 dual or quad process is best 2. Required (16GB) of RAM over Windows 7,8 & 10 3. There should be a (MB) of space for it only
How To Crack?
Firstly, Click on to Download button which is given upper as well as below.
After that, click it and download it to your system
Then, Install into your System
So, run the software on your device.
Check it properly.
All is the installation process is done.
Enjoy Flowjo Crack.
#flowjo 10 crack flowjo 10 serial number crack flowjo crack flowjo crack mac flowjo crack flowjo crack windows flowjo cracked versi
0 notes
Flowjo Crack + Serial Number () Torrent Free Download
Flowjo Crack + Serial Number () Torrent Free Download
Flowjo Crack is a swiss army knife analyzing software program for cytometry data. Moreover, Flowjo creates the latest files in the cytometry standard form, etc. FlowJo Endeavor for your data with an excellent source of your data with full support. Add more, with this you can get more chances to quicken phenotype and immunology research. Furthermore, it is a modern type of application that works best for the next level of research and then gives you a good result in the form of one cell at a time.
Furthermore, the FlowJo Torrent is user-friendly and consists of the main workspace and many different ribbons that contain tabbed bands that permit you to scroll through various bands to access different tasks, etc. Moreover, this amazing software gives you the means to customize each band with the preferred tasks that you usually use. However, by using this tool you can also drag and drop samples or bands on the workspace.
Flowjo With Crack + Torrent [Mac] Download…
Moreover, the FlowJo Crack also can Measurement scales are typically logarithmic with Inordinate precision, etc. however, this method contains many programs within the have a look at health problems, especially most cancers. All in all, the Flowjo mac crack download has the ability to analyze the data on a laptop routinely makes it best for researchers to draw three-dimensional diagrams, etc. add more, the app may be used for each study and clinical purpose and presents good tools and competencies in each field.
All in all, the FlowJo Torrent Free Download trailblaze the new discoveries, indeed through curiosity, style of statistics representation, and much more. And, also the mobile kind is an important aspect for you in which you could check plugins for that. By using this tool you can create new projects daily. Likewise, it is collaborating on the effects you want and then depends upon the platform. However, you don’t need to worry about the lab data construction. Add more, FlowJo has a new trend to create smart projects. you can also download Flowjo mac crack from our site. However, If you think Flowjo serial number generator is more PayPal then don’t worry about it. Here we are providing it totally free. So, visit my site and enjoy Flowjo download cracked.
Key Features:
Furthermore, it is ideal for every kind of user.
It is very fast even you have an original version.
Add more you can also work in free to run your MAC.
Further, it is a perfect memory management system.
More, the frank is its own basic nature to beginners.
It has the ability to makes a new project for biological smart trends.
Also, has new instruments for agnostic problems and platforms.
Add more, one can create files in the cytometer standard format with its help.
Furthermore, scales up you to larger inputs for better improvements.
Moreover, a comprehensive tool works perfectly over Windows & Mac.
More, there are too many FCS files which it accepts for long-time accessibility.
Further, it’s a smart program for trailblazing analysis in or outside the lab.
Add more, Get your new ideas as you want with its help to grow up your research level.
Furthermore, the software is useful only in an advanced environment for the drag-drop feature.
Moreover, a single solution for flow analysis with a compatible view from one file to another, etc.
Likewise, it’s the Best modeling software for data analysis
What’s NEW:
Drag and drop analysis intuitively
Also, has advanced models for advanced data analysis
Furthermore, Publication-quality graphics
All in all, the Plug-in architecture with unique updates
System Requirements:
An Intel Core i7 dual or quad process is best 2. Required (16GB) of RAM over Windows 7,8 & 10 3. There should be a (MB) of space for it only
How To Crack?
Firstly, Click on to Download button which is given upper as well as below.
After that, click it and download it to your system
Then, Install into your System
So, run the software on your device.
Check it properly.
All is the installation process is done.
Enjoy Flowjo Crack.
#flowjo 10 crack flowjo 10 serial number crack flowjo crack flowjo crack mac flowjo crack flowjo crack windows flowjo cracked versi
0 notes
Flowjo envoy
FLOWJO ENVOY HOW TO
FLOWJO ENVOY SERIAL NUMBER
FLOWJO ENVOY INSTALL
Optimizing the use of FJ with these headphones will help you organize your data, improve analytics, and make it easier to understand and explain your data to others. This includes entering and using keywords, creating a push directory for FlowJo keys, distribution spreadsheets, FlowJo and R, and tables in FlowJo License.
FLOWJO ENVOY HOW TO
It’s fast to execute, but ends up with very long names in the output file.įlowJo FCS files are a powerful tool for performing and monitoring flow cytometry to test if you know how to use it properly.
FLOWJO ENVOY SERIAL NUMBER
Flowjo Serial Number This can be as simple as getting people to the editor. Finally, after analyzing the sample, we need to extract valuable data from the target population (% of the population, average fluorescence intensity, etc.). Take the time to add new plugins to your FJX and see how these tools can help manage the instability and productivity of your data. Flowjo freeload This is an advanced method for creating flow stabilization ports where there is an obvious problem with the data that can be generated, but FlowAI exposes many other problem areas.įlowjo Free One important reason is that this data can control the sensitivity of the analysis and increase the range of stakeholders. My favorite is Flowjo and this tool detects anomalies which then clears the data and creates a good and bad intersection. At the top right is a list of members, including the tension each parliament runs.įlowgo axis scale Finally, lower right is a graph of each representative in Parliament over time This will help determine if there are any issues that are significant when researching but are related later. This can be very useful for subsequent organization and data analysis. Flowjo alternative This way you can be sure that your keywords will last. In fact, it is highly recommended to add keywords when creating a file for inclusion in the tool. freeload Flowjo Mac Crack + Serial Number Here you will also see your selected keywords. On the left is a list of all the keywords in the file, from which gadget the recipients captured, etc. This allows you to use tools like SPACE, tSNE, Flow Som, e and more. Flowjo should also refer to the plug-in library software.
FLOWJO ENVOY INSTALL
To take advantage of these plugins, install the R program (for free), and don’t forget to direct FlowJo to the location indicated in the window of your choice. These packages often add some interesting and analytical features to the data.įlowJo License has created what they call a FlowJo portal and a way to transfer R content to FlowJo. Software productivity test packages from Flowjo version have proliferated as R over the past decade. A great infographic and conversion table for each step of editing the post you want to do. Flowjo Use it to process hundreds of forms, create entire tables, and delete slides. It allows you to create powerful batch features simply by dragging and dropping images. FlowJo provides an easy interface for the most demanding multivariate analysis systems. It performs a comprehensive analysis of thousands of models with millions of high-resolution accident cases. FlowJo Crack + Torrent For (Mac + Windows) freeloadįlowjo Crack is a scientific diagnostic software designed for streaming cellular data.
#Flowjo envoy
0 notes
Flowjo serial number mac generato
#FLOWJO SERIAL NUMBER MAC GENERATO CRACKED#
#FLOWJO SERIAL NUMBER MAC GENERATO SERIAL NUMBER#
#FLOWJO SERIAL NUMBER MAC GENERATO FULL CRACK#
#FLOWJO SERIAL NUMBER MAC GENERATO SOFTWARE#
Because of these circumstances, the test will guide you to the next stage of research. Therefore, being close to various notable instruments and features can help you to smooth the edges of your ideas to enhance the work cycle. Additionally, the cell type is a significant aspect which is why you should examine modules to help you with the information. It will analyze the revelations principally through the top way of displaying data. To summarize this, it is important to note that the FlowJo Crack is by and offering you an internet-based platform for the organization of turning to devour. It also provides the structure of a component that it is possible to do what you’d like to.
#FLOWJO SERIAL NUMBER MAC GENERATO SERIAL NUMBER#
Since FlowJo Serial Number provides another example to help you take advantage of, you can make a sharp start. There is no reason to worry about the development of lab data. It also cooperates with the results you desire and then depends on the setting. This way it’s notable in arranging the data to be used to make it easier for you to go on adventures. In order to move data in new methods, you can look at more information after eliminating the cell appraisal information and consequently the amazing idea of enunciation for data sets, etc. It is able to explore basic data used to conduct research. The current installer for this program will provide you with a lot of information to stream the cytometry. Performing a flow cytometry analysis is vital to diagnose health problems, especially blood cancers, but it can be helpful with other specialized applications for research and practice that is clinical. you can take your analysis towards the level that is next brand new features including spectral settlement, platform overlays, is now launching you an online source for the creation of turn burning.
#FLOWJO SERIAL NUMBER MAC GENERATO SOFTWARE#
This is a higher-level variety of software that works best for the next level of research and then provides you the end result that is best in the form of one cell at any given time.įlowJo Crack is an application that is powerful offers you a built-in environment for displaying and analyzing flow cytometric data. Right here, you are able to get more chances to accelerate immunology and phenotype research. FlowJo Serial Number strives for a highly skilled source to the data of your data with complete support. It makes brand new files within the cytometry form that is standard. The script editor allows access that is low-level FlowJo You may also organize projects that are numerous with this tool.įlowJo Torrent is a software that is analyzing cytometry data. This really is the world’s analyzing tool that is best. However, it is possible to also develop projects that vary daily basis. This really is additionally a tool that is universal evaluating. It is also a tool that is outstanding in examining.
#FLOWJO SERIAL NUMBER MAC GENERATO CRACKED#
You can get any cracked software With Lastest Keys from our website.įlowJo Crack is also most readily useful with page rulers with page breaks. Further, it also provides you with a program that is user-friendly. It also enables you to generate illustrations for publications or presentations. More, you can even run this device on Windows, Mac, and Linux. It additionally enhanced your amount of analysis. This device is commonly used by researchers and technicians.
#FLOWJO SERIAL NUMBER MAC GENERATO FULL CRACK#
DOWNLOAD FULL CRACK FlowJo Crack With Serial Number freeload įlowJo Crack provides you with an environment that is integrated viewing and analyzing flow cytometry information.
#Flowjo serial number mac generato
0 notes
Flowjo serial number free
#FLOWJO SERIAL NUMBER FREE SERIAL KEY#
#FLOWJO SERIAL NUMBER FREE FULL VERSION#
Speed up routine phenotyping available as you know it. FlowJo Crack Torrent + License key freeloadįlowJo Crack catalyzes and analyzes without any restrictions. You can also download this tool from our secure link. The download process for this tool is also simple. There are also billions of users of this tool. It also provides you with drag and drop functionality. The user of this tool is available all over the world. This program can be used for both research and clinical purposes. In the latest version, programs have been developed for the decomposition and display of information about streams. It is also the best platform for analysis. The entire analysis process is also carried out in a very short period of time. In addition, the speed of this tool is amazing. The design of the main window not only allows you to explore the basic functions of FlowJo. There are many other great features of this tool. This is everyone’s basic need for analysis. The Group section allows you to organize the samples in the order in which you want to analyze them. In addition, you can drag samples or bands to the workspace.
#FLOWJO SERIAL NUMBER FREE FULL VERSION#
FlowJo Crack Keygen Full Version freeloadįlowJo Crack allows you to customize each group with your favorite tasks that you usually use. Because FlowJo features a tendency to create wise projects. It is currently working on the ramifications that you then are contingent on the platform and desire. It is a favorite for coordinating the data to get projects. After that excellent caliber of saying you’ve got to get data sets, etc. For your delivery of fresh ways, you also can observe more stuff later expressing the penetration of cell review. That is a sophisticated form of application that is most suitable for the degree of study after which provides you the lead to the shape of a single cell at one time.įlowjo Crack can lead you a lot to flow cytometry. Here, you’ll get more opportunities to quicken immunology and phenotype research. FlowJo tries your computer data using a superb supply of one’s data with support. It makes files from the form that is cytometry.
#FLOWJO SERIAL NUMBER FREE SERIAL KEY#
Click To Download Flowjo Crack Serial Key Full Latest Version freeload įlowjo Crack is assessing applications for cytometry data.
#Flowjo serial number free
0 notes
Flowjo serial number free
FLOWJO SERIAL NUMBER FREE CRACKED
FLOWJO SERIAL NUMBER FREE MOVIE
Currently Age Of Empires 2 HD freeload PC game is the newest expansion pack for the game released after quite a long time.
Age Of Empires 2 HD freeload is basically the second flagship expansion pack for a marvelous strategy game (Age Of Empires 2 The Age Of Kings).
FLOWJO SERIAL NUMBER FREE CRACKED
- freeload PC Games Cracked full and complete game & repack from Mega, Uptobox, 1fichier, Turbobit, Uploaded, Zippyshare, bilin.com.mxise, simply click the 'FlowJo Portal Sign In' button at the top and enter your personal Portal account credentials. If you start with a serial number and your lab expands with more computers you can convert. If your computer has been used previously using the prior HWA system, you will need to remove that serial license number located in the middle right of that tab. It is a good option for labs and users who don’t want to worry about losing a dongle (or getting it stolen) or who only have one workstation they will be using for analysis. are the two new lush and splendid tweaks of Age Of Empires 2 HD freeload. A license number will run FlowJo on one, and only one, computer. Treaty and Capture The Relic Lecrae albums freeload. One of the best attributes of this game are the new included Civilizations such as the Indians, Italians, Slavs, and Incas and Magyars. When FlowJo is launched for the first time, the FlowJo license information window will open with the licensing agreement and license options. We encourage you to update to the most recent version of FlowJo. First Name: Last Name: Institution: Country: AFGHANISTAN ALBANIA ALGERIA AMERICAN SAMOA ANDORRA ANGOLA ANGUILLA ANTARCTICA ANTIGUA AND BARBUDA ARGENTINA ARMENIA ARUBA AUSTRALIA AUSTRIA AZERBAIJAN BAHAMAS BAHRAIN BANGLADESH BARBADOS BELARUS BELGIUM BELIZE BENIN. This expansproton of Age Of Empires II is also known as Age Of Empires II The Forgotten freeload. To obtain a trial day serial number so that you may try FlowJo with your data please fill out the form on our day trial serial number page. Please fill in the fields to receive a 30 day FlowJo serial number. Currently Age Of Empires 2 HD freeload PC game is the newest expansproton pack for the game released after quite a long time.
FLOWJO SERIAL NUMBER FREE MOVIE
It might be a funny scene, movie quote, animation, meme or a mashup of multiple sources. Age Of Empires 2 HD free download is basically the second flagship expansproton pack for a marvelous strategy game (Age Of Empires 2 The Age Of Kings). You can take any video, trim the best part, combine with other videos, add soundtrack.
#Flowjo serial number free
0 notes
Copytrans activation code generator download
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD FOR MAC#
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD CRACKED#
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD SERIAL KEY#
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD FULL VERSION#
There’ll be programs convey and to share with you the application form.
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD SERIAL KEY#
The application form to store and move connections cloudly can manage by you and the driver deal with the MAC and install at no cost.ĬopyTrans Serial Key variant keeps anyone away from file conversion, improves the i-OS experience, and can help you a whole good deal more time upgrading and program snapping. That is videos, transfers, and music all for all of your devices. That is just a data unit that performs simultaneous purposes such as sharing, data manipulation, and conversion around MAC, IOS, along with Android and handles all.ĬopyTrans Crack is Con-Tact managing perfect tool over Iphones, Ipods, and Ipad pills prepared to copy the utilized plug-in that is data-HEIC using a simple solution up on Windows. The computer software will be here now prepared to allow everybody else.
Connect your iPod, iPhone, or iPad to PC without iTunesĬopyTrans Crack Activation Code Torrent Latest Download For MacĬopyTrans Crack is a control center having to begin a system within mutually that is dual-platform.
What’s New In CopyTrans Crack Latest Version?.
CopyTrans Crack Main Features:.
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD FULL VERSION#
CopyTrans Crack Full Version Torrent Download For Win/Mac:.
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD FOR MAC#
CopyTrans Crack Activation Code Torrent Latest Download For bilin.com.mx restore the original MAC address of the network adapter, select the adapter, click Restore Original button in the Change MAC Address bilin.com.mx may even click Random MAC Address button to fill up a randomly selected MAC address from the vendor list available. Enter new MAC address in the field and click Change Now! button. In the Information tab, find the Change MAC Address bilin.com.mx will get the details of your selection below. Select the adapter you want to change the MAC bilin.com.mxng MAC address changer will list all available network bilin.com.mx can be found in the Advance settings tab in the Network Adapter's Device properties in Windows Device Manager. Some Network Adapter drivers have this facility built-in. If a value is present, windows will use it as MAC address, if not, windows will use the hard coded manufacturer provided MAC address. When the Network Adapter Device is enabled, windows searches for the registry value 'NetworkAddress' in the key HKEY_LOCAL_MACHINESYSTEMCurrentControlSetControlClass. This software just writes a value into the windows registry. You will then receive a license code which you can put into the software. 2 min - Uploaded by Keygen Free HereFlowJo Crack Full Serial Number + Torrent Mac+Win. Flowjo 10 Serial Number Crack 10 Serial Number Crack.
#COPYTRANS ACTIVATION CODE GENERATOR DOWNLOAD CRACKED#
6 PC x32/圆4 and MAC cracked full download. FlowJo lies within Development Tools, more precisely Database Tools. FlowJo can be downloaded from our website for free. Adobe Illustrator Mac Crack freeload The enterprise-general vector pics software program lets you create emblems, icons, drawings, typography, and illustrations for print, internet, video, and mobile. Apple, in its line of amazing Mac OX titles, launched the Mac OS Yosemite which took the world by storm. Mac OS X Yosemite is another product in Apple’s line of Mac OS X. Note: Let Us Know In the comments if any link is not working, We will update ASAP.
#Copytrans activation code generator download
0 notes
Flowjo Crack
is an evaluation device for applications that gather cytometry data. It produces records in the configuration that is cytometry. Flowjo Serial Key program tests your PC’s information overwhelmingly of information, with help. This is where you’ll track down more prominent chances to accelerate the method involved with phenotyping and immunology. It permits you to test the consequences of your exploration. To introduce your discoveries in better approaches to introduce your discoveries, you may likewise take a gander at more data later to show the effect of the survey of cells.
There is no prerequisite Since FlowJo Serial number tends to configuration savvy projects. A mind-boggling type of utilization’s suitable for the degree of exploration and provides you with the type of a solitary cell simultaneously. FlowJo Mac Crack is programming for investigating to break down cytometry information. It creates new records involving the standard arrangement for cytometry. FlowJo takes a stab at your information by giving an outstanding wellspring of your information that is completely upheld.
Following that awesome way of saying you really want to gather informational collections, etc. The group is exploring the ramifications that will rely on the application and your longing. Flowjo Full Cracked can assist you with learning numerous headings for stream Cytometry. Near different marvelous gadgets comparably to the different current features will become the smooth out of your tips to redesign the work example of it.
0 notes
FlowJo Crack + Keygen Download % Working FlowJo Crack is a commercial application that has an integrated environment for viewing and analyzing flow cytometry data. The weather display functions as a workspace, with
#FlowJo FlowJoCrack FlowJoSerialKey FlowJoFreeDownload FlowJoDownload FlowJoSoftware FlowJoMac FlowJoLicenseKey FlowJoFullVersion FlowJoT
0 notes
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: ImageQuant TL is the most automatic and easy-to-use general image analysis software available. It provides
• Automation for fast and consistent results.
• Optional ImageQuant SecurITy modules, designed to support and control traceability of data.
• Support of multicolor files.
• Editing tools to crop, rotate, and filter images.
• Advanced algorithms for delivery of accurate results.
Make:GE Healthcare
Form/Manual: Image QuantTL Gel Analysis/Quantitation Form
Administrator: Sonja Young
Administrator Contact: ()
Application: Agilent's GeneSpring GX software provides powerful, accessible statistical tools for fast visualization and analysis of microarrays - expression arrays, miRNA, exon arrays and genomics copy number data. Designed specifically for the needs of biologists, GeneSpring GX offers an interactive desktop computing environment that promotes investigation and enables understanding of microarray data within a biological context.
Make:Agilent Technologies
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: FlowJo is a software package that is capable of analyzing flow cytometry data. All files produced by assorted flow cytometers are written in the Flow Cytometry Standard format with an .fcs file extension. FlowJo will import and analyze cytometry data regardless of which FACS (Fluorescence Activated Cell Sorting) insrument/software is used to collect the data.
To use the Software please contact "Sandy" Ying-Sin Hsieh, who will explain how to download the software to your computer. The software access privileges are sometimes donglebased, and therefore will require you to sign-out for a dongle from PSC or come to some other arrangements with Flow-Jo.
Make:FlowJo
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: DeCyder 2-D Differential Analysis Software is specifically designed for 2-D fluorescence difference gel electrophoresis (DIGE) analysis and is a key element in the Ettan DIGE system (which we have). It is fullyully optimized and integrated to the 2-D DIGE platform.
Make:GE Healthcare Life Sciences
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: ImageMaster 2D software offers a flexible interface for the comprehensive visualization, exploration, and analysis of 2-D gel data from both 2-D DIGE (2-D fluorescence difference gel electrophoresis) and non-DIGE technologies. It is provided as altrenative to the use of Decyder 2D amalysis Software
Make:GE Healthcare Life Sciences
Form/Manual:ImageMaster 2D Proteomics Analysis Manual
Administrator:"Sandy" Ying Sin Hsieh or Sonja Young
Administrator Contact:
Application: The importance of sterilization is essential to good laboratory practice, particularly in biotechnology, pharmaceutical and clinical laboratories. Of all sterilization methods, high pressure steam (autoclave) is the most widely used because of its efficacy, speed and reliability. The department has a number of autoclaves, some run by steam and others use steam, but the steam is generated by water loaded into the autoclave and electricity.
Autoclaves are used in a wide variety of applications including:
• culture media preparation
• labware sterilization
• waste sterilization
Make:Steris/AMSCO
Administrator:Sonja Young
Administrator Contact:
Application: The importance of sterilization is essential to good laboratory practice, particularly in biotechnology, pharmaceutical and clinical laboratories. Of all sterilization methods, high pressure steam (autoclave) is the most widely used because of its efficacy, speed and reliability. The department has a number of autoclaves, some run by steam and others use steam, but the steam is generated by water loaded into the autoclave and electricity. Autoclaves are used in a wide variety of applications including:
• culture media preparation
• labware sterilization
• waste sterilization
Make: Sanyo, Hirayama, and New Brunswick
Administrator:Hyuk-Kyu Seoh
Administrator Contact:
Application: Thermo Electron offers the FRENCH Press and two models of FRENCH Pressure Cells for the disintegration of chloroplast materials, blood cells, unicellular organisms, homogenates of animal tissue and other biological particles. The pressure cell disrupts the cellular walls of a sample while leaving the cell nucleus undisturbed. This technique results in more uniform and complete disruption. The FRENCH Pressure Cell delivers higher pressures than bombs or decompression systems, without pre-treating the sample. Cells are lysed by forcing the cell or tissue suspension through a narrow space, thereby shearing the cell membraneøs.A French press consists of a piston that is used to apply high pressure to a sample volume of 40 to ml, forcing it through a tiny hole in the press. It can reach pressures of 20,, pounds per square inch (psi).
Make: Thermo Electron
Form/Manual:French Press Operation Manual
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: The Sonifier® ultrasonic cell disruptors are versatile laboratory tools designed to apply high-frequency ultrasonic energy to biological and chemical processing to provide:
• Cell disruption
• Nano particles
• Emulsifications
• Homogenization
• Cell lysis
• Processing DNA & proteins
• Fine mixing
• Degassing
Make: Fisher / Emerson Industrial Automation
Form/Manual:Sonicator Tip Operations Manual
Administrator:Hyuk_Kyu Seoh
Administrator Contact: ()
Application: The Sonifier® ultrasonic cell disruptors are versatile laboratory tools designed to apply high-frequency ultrasonic energy to biological and chemical processing to provide:
• Cell disruption
• The bath adapter allows for the simultaneous sonication. didruption of cells surrounded by ice water, to • unify cell disruption
Make: Fisher / Emerson Industrial Automation
Form/Manual:Sonicator (Bath) Operations Manual
Administrator:George Pierce
Administrator Contact:
Application: This system allows for continuous temperature control constantly maintaining cell suspensions at a low temperature. It offers a controlled cell breakage rate, and direct steam sterilization and flushing with antiseptics (DynoMill brochure).
Make: DynoMill
Form/Manual:KDL Agitator Bead Mill Service Form
Administrator:Sonja Young
Administrator Contact:
Application: The particle’s settling velocity in centrifugation is a function of the particle’s size and shape, centrifugal acceleration, the volume fraction of solids present, the density difference between the particle and the liquid, and the viscosity. The Avanti J has a fast accel/decel rate and can process large volumes of solutions. The rate of separation depends on the rotor radius and type.
Make: Beckman
Form/Manual:Avanti J Floor Operation Manual
Administrator:Sonja Young
Administrator Contact:
Application: The particle’s settling velocity in centrifugation is a function of the particle’s size and shape, centrifugal acceleration, the volume fraction of solids present, the density difference between the particle and the liquid, and the viscosity. The Avanti J XP has a fast accel/decel rate and can process large volumes of solutions. The rate of separation depends on the rotor radius and type.
Make: Beckman
Form/Manual:Avanti J XP Floor Operation Manual
Administrator:Sonja Young
Administrator Contact:
Application: The particle’s settling velocity in centrifugation is a function of the particle’s size and shape, centrifugal acceleration, the volume fraction of solids present, the density difference between the particle and the liquid, and the viscosity. The Avanti J has a fast accel/decel rate and can process large volumes of solutions. The rate of separation depends on the rotor radius and type.
Make: Beckman
Form/Manual:Avanti J Floor Operation Manual
Administrator:Sonja Young
Administrator Contact:
Application: The particle’s settling velocity in centrifugation is a function of the particle’s size and shape, centrifugal acceleration, the volume fraction of solids present, the density difference between the particle and the liquid, and the viscosity. The Avanti JI has a fast accel/decel rate and can process large volumes of solutions. The rate of separation depends on the rotor radius and type.
Make: Beckman
Form/Manual:Avanti JI XP Floor Operation Manual
Administrator:Sonja Young
Administrator Contact:
Application: The Sorvall RC5B can process large volumes of solutions. The rate of separation depends on the rotor radius and type.
Make: Sorvall
Form/Manual:Operation Manual
Administrator:Sonja Young
Administrator Contact: ()
Application: Centrifuge R is a high speed, refigerated centrifuge for medium capacity needs. It allows for molecular applications in tubes up to mL and offers additional swing-bucket and fixed-angle rotors as well as deepwell plate capacity for increased versatility.
Make: Eppendorf
Form/Manual: Refrigerated Tabletop Operation Manual
Administrator:Sonja Young
Administrator Contact: ()
Application: Centrifuge and R are -high speed centrifuges for medium capacity needs. They allow for molecular applications in tubes up to mL and offer additional swing-bucket and fixed-angle rotors as well as deepwell plate capacity for increased versatility.
Make: Eppendorf
Form/Manual: R Tabletop Operation Manual
Administrator:Sonja Young
Administrator Contact: ()
Application: The Centrifuge R combines the proven features of the Eppendorf microcentrifuges and the multipurposecentrifuges. They offer multiple application opportunities due to a high selection of different rotor types. Despite their compact size of approx. 35 cm width, special rotors for micro plates, 15 mL and 50 mL conical tubes can be easily used. Their incomparable versatility makes the Centrifuge and Centrifuge R the flagships under the Eppendorf microcentrifuges.
Make: Eppendorf
Form/Manual: R Tabletop Operation Manual
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: ÄKTA™Purifier and Explorer chromotography systems are designed for fast development and optimization of any biomolecular purification, using one working platform for all techniques and samples.
Applications: The method wizard and optimized system configurations, allows rapid media screening, method scouting, method optimization, and scaleup experiments. Standard system configurations are available to suit most purification needs, but are easily modified if required.
• Protein, peptide, nucleic acid purification in micro and gram scales
• Programmable sequential application of different columns up to 8
• Automated sample load up to 8 different samples or sequential load of samples
• Automated fraction collection in bulk or small fractions
• BufferPrep calculates and prepares the correct pH buffers
• Samples can be applied at flow rates up to 50 ml/min. and fractions can be collected without spillage at flow rates up to ml/min.
Make:GE Healthcare
Form/Manual:
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: ÄKTA™Pure chromotography systems are designed for the rapid development and optimization of biomolecular purification, using one working platform for all techniques and samples.
Applications: The method wizard and optimized system configurations, allows rapid media screening, method scouting, method optimization, and scaleup experiments. Standard system configurations are available to suit most purification needs, but are easily modified if required.
• Protein, peptide, nucleic acid purification in micro and gram scales
• Programmable sequential application of different columns up to 8
• Automated sample load up to 8 different samples or sequential load of samples
• Automated fraction collection in bulk or small fractions
• BufferPrep calculates and prepares the correct pH buffers
• Samples can be applied at flow rates up to 50 ml/min. and fractions can be collected without spillage at flow rates up to ml/min.
Further Information:GE Healthcare
Make:GE Healthcare
Form/Manual:
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application:ÄKTA™ Purifier and Explorer chromotography systems are designed for fast development and optimization of any biomolecular purification, using one working platform for all techniques and samples.
Applications: The method wizard and optimized system configurations, allows rapid media screening, method scouting, method optimization, and scaleup experiments. Standard system configurations are available to suit most purification needs, but are easily modified if required.
• Protein, peptide, nucleic acid purification in micro and gram scales
• Programmable sequential application of different columns up to 8
• Automated sample load up to 8 different samples or sequential load of samples
• Automated fraction collection in bulk or small fractions
• BufferPrep calculates and prepares the correct pH buffers
• Samples can be applied at flow rates up to 50 ml/min. and fractions can be collected without spillage at flow rates up to ml/min.
Make:GE Healthcare
Form/Manual:
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: ÄKTA start is an easy-to-use chromatography system that automates the rapid, manual purification procedures using small volume chromatography columns, for example HiTrap columns.
Further Information:GE Healthcare
Make:GE Healthcare
Form/Manual:
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application:ÄKTA™Purifier and Explorer chromotography systems are designed for fast development and optimization of any biomolecular purification, using one working platform for all techniques and samples.
Applications: The method wizard and optimized system configurations, allows rapid media screening, method scouting, method optimization, and scaleup experiments. Standard system configurations are available to suit most purification needs, but are easily modified if required.
• Protein, peptide, nucleic acid purification in micro and gram scales
• Programmable sequential application of different columns up to 8
• Automated sample load up to 8 different samples or sequential load of samples
• Automated fraction collection in bulk or small fractions
• BufferPrep calculates and prepares the correct pH buffers
• Samples can be applied at flow rates up to 50 ml/min. and fractions can be collected without spillage at flow rates up to ml/min.
Make:GE Healthcare
Form/Manual:
Administrator:Hyuk Kyu Seoh
Administrator Contact: ()
Application: The MDQ is a capillary-based analytical system separates sample components within a fused-silica capillary, using one of several modes of electrophoresis.
Applications: Examples of the different modes of electrophoresis include:
• Capillary Zone Electrophoresis
• Micellar Electrokinetic Capillary Chromatography
• Capillary Gel Electrophoresis
• Capillary Isoelectric Focusing
• Capillary Electrochromatography.
The system includes a P/ACE MDQ configured with both a photo diode array and selectable-wavelength UV/Vis (, , and nm filters included) detector, UV source optics, temperature-controlled sample storage module and 32 Karat™ Software. Typical applications are:
• Genetic analysis
• Chiral analysis
• Fast RNA purity analysis
• Basic drugs analysis
• Ion analysis
• Protein and Peptide analysis
Make: Beckman
Form/Manual: MDQ Service Form
Administrator: Hyuk Kyu Seoh
Administrator Contact:
Application: The Beckman HPLC has solvent delivery modules that are built with a rapid fill pump design that produce smooth flow from microbore to semi-preparative flow rates and thee high-pressure mixing design eliminates the need for constant helium sparging or degassing. The pumps are combined with high-sensitivity UV/VIS and diode array detectors and autosamplers. Flow range: - ml/min.; wavelength range: - nm; Maximum back pressure: 17 ul capacity flow cell; Programmable functions: wavelength, range, rise time, auto zero, event mark, relays, lamp off, peak detection, peak threshold, bandwidth and stop data.
Preparative HPLC refers to the process of isolation and purification of compounds. Important is the degree of solute purity and the throughput, which is the amount of compound produced per unit time. This differs from analytical HPLC, where the focus is to obtain information about the sample compound. Chemical Separations can be accomplished using HPLC by utilizing the fact that certain compounds have different migration rates given a particular column and mobile phase. Each compound should have a characteristic peak under certain chromatographic conditions. Depending on what needs to be separated and how closely related the samples are, the chromatographer may choose the conditions, such as the proper mobile phase, to allow adequate separation in order to collect or extract the desired compound as it elutes from the stationary phase. With these characteristic peaks, identification of compounds can be done. HPLC also allows for quantification of compounds by determining the unknown concentration of a compound in a known solution.
Make: Beckman
Form/Manual: HPLC Service Form
Administrator:Sonja Young
Administrator Contact: ()
Application: The Concentrator plus from Eppendorf is available in two configurations:
Complete system with an integrated service-free diaphragm pump
Basic concentrator for connecting to an existing vacuum.
The Concentrator’s heating technology optimizes the evaporation process. No matter which configuration you choose, you’re assured of quick and efficient—yet gentle—vacuum concentration of your samples (e.g. DNA/RNA, proteins).
The complete system includes a vapour condenser that purifies the exhaust air by up to 85%. This serves as protection against unpleasant vapours.
Make:Eppendorf
Form/Manual: Speed Vac Concentrator Operation Manual
Administrator:Sonja Young
Administrator Contact:
Application: The Vacufuge Concentrator is a complete system with solvent-resistant PTFE vacuum pump and vapor trap. Narrow, inch width saves valuable bench space. Motorless drive and sealed chamber provide trouble-free operation Evaporation Modes:
• Choice of three (aqueous, alcohol, off) to correspond with sample solvent and reduce processing time up to 20%.
• Maximize evaporation efficiency and prolong pump lifespan by periodically aerating the vacuum line, preventing condensation build-up.
Automatic vacuum release prevents sample loss from bumping and foaming. Brake feature brings rotor to a faster stop—allows quick access to samples. Choice of four heating levels (30°C, 45°C, 60°C, and ambient) allows safe and efficient concentration of a variety of samples. Besides the microfuge tube rotor, there is a micro plate rotor available upon request (see Debby).
Make:Eppendorf
Form/Manual: Vacufuge Operation Manual
Administrator:Ping Jiang
Administrator Contact: ()
Application:The capillary xl DNA Analyzer is the Gold Standard for high throughput genetic analysis. Use this for DNA fragment analysis applications such as microsatellites, AFLP, SNP analysis, mutation detection and traditional DNA sequencing. Get the highest quality data at a low cost per sample.
• Higher optical sensitivity and advanced polymers enable you to obtain higher-quality sequencing data for less.
• Multiple automation features decrease costly human errors.
• Optimized polymers increase your productivity without compromising your results.
• Perform a wide variety of sequencing and fragment analysis applications including resequencing, microsatellite analysis, AFLP, LOH, SSCP, SNP screening and SNP validation.
Make:Life Technologies
For Use and Further Information: DNA Sequencing Services
Administrator:Ping Jiang / Sonja Young
Administrator Contact: ()
Application: The Ion OneTouch™ 2 System simplifies the workflows for the Ion Proton™ and Ion PGM™ systems by providing an automated solution for scalable and reproducible template preparation. The Ion OneTouch™ 2 System: • Integrates multiple manual template preparation workflows into a single system
• Enables parallel processing of multiple samples per day through modular design
• Supports scalable template preparation for all Ion semiconductor sequencing chips
• Supports up to bases on the Ion PGM™ System and up to bases on the Ion Proton™ System*
• Includes a full thermal cycling modality for amplification for quick optimization of thermal cycling parameters
• Employs a peristaltic pump fluidic system that eliminates the need for gas
• Fits easily on any benchtop with its small instrument footprint
Make: Life Technologies (Thermofisher)
For Use and Further Information: DNA Sequencing Services
Administrator:Ping Jiang / Sonja Young
Administrator Contact: ()
Application: The IonS5 System combines semiconductor sequencing technology with natural biochemistry to directly translate chemical information into digital data, democratizing sequencing and making it accessible to virtually any lab or clinic. The Ion GeneStudio S5 Series is flexibly designed to enable a broad range of targeted NGS RNA/DNA sequence applications with industry-leading speed and scalability. Select from five different sequencing chips to sequence a throughput range from 2M to M reads per run. Simply choose the chip size and the instrument that matches your throughput and application needs.
Make: Life Technologies (Thermofisher)
For Use and Further Information: DNA Sequencing Services
Administrator:Ping Jiang / Sonja Young
Administrator Contact: ()
Application: The Ion Chef™ System is the next generation of workflow simplification products for the Ion Proton™ and Ion PGM™ systems. The Ion Chef™ System provides automated, high-throughput template preparation and reproducible chip loading for users at any experience level. With typically less than 15 minutes of hands-on time, an intuitive touch-screen interface, and significantly higher productivity than the Ion OneTouch™ 2 System, the Ion Chef™ System makes the Ion Torrent™ sequencing workflow accessible for every lab.
Make: Life Technologies (Thermofisher)
For Use and Further Information: DNA Sequencing Services
Administrator:Ping Jiang / Sonja Young
Administrator Contact: ()
Application: The Ion Proton™ System offers a complete workflow from sample through analysis, and variant calling or RNA analysis. It is used with the Ion Chef™ System* to enable automated, high-throughput template preparation and reproducible chip loading for users of any experience level. Built for speed, the Ion Proton™ System provides sequencing run times from 2–4 hours on the Ion PI™ Chip, taking you from DNA to variants in a single day. It is equipped with Ion Reporter™ Software, providing integrated tools for tertiary data analysis for DNA variation analysis across single, paired, or trio research samples.
Make: Life Technologies (Thermofisher)
For Use and Further Information: DNA Sequencing Services
Administrator:Sonja Young
Administrator Contact: ()
Application: The nCounter SPRINT platform is capable of degitally analyzing multiple pathways in a single tube in an extraction-free workflow requiring only 10 minutes of hands-on time -significantly benefiting your RNA, DNA, and protein profiling applications.
Make: Nanostring Technologies
For Use and Further Information:
For Basic Use Capabilities:Online Information
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact:
Application: This system lets you enhance resolution by entering two blocks of running conditions to be executed successively. The CHEF-DR II system is optimized for the most popular range of separations with a fixed angle of °. This unit can be used for separations of fragments up to 6 Mb in size by adjusting the running conditions for low voltage and extended run times. Besides mapping, this system can be used for:
• Strain typing-molecular epidemiology
• Apoptosis assays
• DNA damage and repair studies
• Large protein separations
Pulsed Field Gel Electrophoresis Is Still the Benchmark for Mapping Applications such as: • Disease locus mapping
• YAC, BAC, PAC, and cosmid mapping
• Chromosome rearrangements
• RFLP and DNA fingerprinting
Make: BioRad
Form/Manual:CHEF DR II Pulse Wave
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: Simple Western by ProteinSimple effectivley reinvents the entire Western blot process without gels, transfer tanks, blots or film - finally giving researchers a complete, walk-away solution for protein detection and characterization. All hands-on steps from sample loading and detection to quantitative data analysis are completely automated, eliminating the manual factors that can negatively impact reproducibility, quantitation, time to result and data reliability. Simon analyzes 12 samples per run in hours! Funding provided by Tech fee.
Make: Protein Simple
Form/Manual: Protein Simple Simon Western
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application:T he Gene Pulser Xcell™ system is a modular electroporation system for transfecting every cell type. The system includes a main unit, a ShockPod™ cuvette chamber, and your choice of accessory modules: the capacitance extender (CE module) and the pulse controller (PC module).
Features and Benefits:
• Universal electroporation — transfects all cell types, from primary and stem cells to bacteria and yeast
• Preset protocols — include the most common mammalian and bacterial cell types
• Flexibility — choice of programs for preset protocols, optimization protocols, manual operation, and/or user protocols
• Protocol library — collection of electroporation protocols for every cell type including primary, • immortal, and bacterial cells
• Data management — enables storage and recall of parameters used in the previous experiments, useful for troubleshooting
• Reproducibility — uses PulseTrac™ circuitry and arc-protection features to ensure reproducibility and sample protection
Make: BioRad
Form/Manual: Gene Pulser Xcell
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: The MicroPulser electroporator is a simple yet versatile instrument that enables safe and reproducible transformation of bacteria, yeast, and other microorganisms. Transformation efficiencies much higher than those obtained with chemical methods can be achieved.
Key Features:
• One-button pulse delivery, attached cuvette chamber, and rapid charge time for fast sample handling
• Preset, optimized programs for commonly studied bacteria and fungi allow rapid program selection
• Arc quenching (ARQ) system significantly reduces arcing, protecting against loss of valuable samples
• Broad range of parameters for manual optimization. Manual programming allows voltage to be selected • in a –3, V range with 10 V precision and allows pulse width to be selected in a – ms range with ms precision
• High-voltage 3, V capability yields improved efficiency in larger-volume cuvettes
• Compact, space-saving design
• Audible and visible pulse indicators
• Time constant and actual volts displayed to monitor reproducibility
Make: BioRad
Form/Manual: Micropulser Operation Manual
Administrator:Sonja Young
Administrator Contact: ()
Application: The X-OMAT A processes exposed radiographic film. The exposed film sheet is placed into an automatic film processor. The film is processed via rollers through tanks containing developer and fixer solutions, and finally through a wash system. The developed film emerges from the processor ready for reading by the researcher.
Make: Kodak
Form/Manual: X-Omat A Operation Manual
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: The BD Accuri™ C6 is a personal flow cytometer that is easy to use, simple to maintain, and affordable. The analytical power and versatility of today’s laser-based flow cytometry systems have unlocked the mysteries of cell biology and empowered entirely new fields of research. As a result, flow cytometry has become a staple of modern laboratories around the world.
Make:BD Biosciences
Form/Manual: Accuri C-6 Blue/Red
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: This benchtop system delivers high-speed sorting and multicolor analysis. The BD FACSAria instrument is the first benchtop sorter that incorporates a fixed-alignment cuvette flow cell, which minimizes startup time and improves reproducibility. This new flow cell provides superior fluorescence sensitivity and freedom from instrument maintenance and alignment. Gel coupling to the objective lens improves collection efficiency and increases sensitivity and resolution needed ofr multicolor sorting applications. Additional "Sort setup" and "sort monitoring" features in the system software makes the BD FACSAria instrument easy to use. BD FACS™ Accudrop technology is integrated into the system for quick and accurate drop-delay determination. Stream monitoring of the breakoff point and clog detection are incorporated. The system has four air-cooled lasers at nm, nm, nm and nm wavelengths. Two- and four-way bulk sorting devices for a variety of tube sizes are also available. Water Jacketed tube holders are also available to keep cells warm or cold as needed.
Applications are far reaching and can be found on the BD online tutorial.
Make:BD Biosciences
For Use and Further Information: Flow Cytometry and Cell Sorting Services
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: Built on more than 25 years of BD experience and leadership in flow cytometry and multicolor analysis, the BD FACSCanto™ II system is an easy-to-use benchtop analyzer that delivers proven performance, accuracy, and high-quality results.
The BD FACSCanto II provides the ultimate in flexibility and can be configured with two or three lasers to detect up to eight colors.*
Applications are far reaching and can be found on the BD online tutorial.
Make:BD Biosciences
For Use and Further Information: Flow Cytometry and Cell Sorting Services
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: The Auto utilizes bright field imaging and dual-fluorescence imaging to quickly and accurately identify and count individual cells. Cell count, concentration, diameter, and % viability are automatically calculated and reported.
Make:Nexcelom
Form/Manual: Cellometer Cell Counter
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: The BD LSRFortessa™ cell analyzer offers the ultimate in choice for flow cytometry, providing power, performance, and consistency. Designed to be affordable and expandable, the BD LSRFortessa has the flexibility to support the expanding needs of multicolor flow cytometry assays.
The Fortessa is configurable and upgradeable with up to 4 lasers to detect up to 18 colors simultaneously, BD LSR analyzers feature innovative designs for both the excitation optics and collection optics that reduce excitation losses and improve light collection efficiency. Our instrument has blue ( nm), red ( nm),yellow-green ( nm) and violet (nm) lasers. The addition of the yellow-green laser allows use of the new fruit fluorescent proteins such as mCherry. It also limits spectral overlap between FITC and PE – 2 of the most common fluorescent markers used in flow cytometry.
Applications are far reaching and can be found on the BD online tutorial.
Make:BD Biosciences
For Use and Further Information: Flow Cytometry and Cell Sorting Services
Administrator: Sonja Young and "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: Maintain viable stocks and strains at °C
Make: Thermo
Form/Manual: Freezer Manual
Administrator:Sonja Young and Hyuk Kyu Seoh
Administrator Contact: and
Application: Sublimation occurs when a frozen sample goes directly to the gaseous phase without passing through the liquid phase. As the ice sublimates, it leaves voids in the dry residual material making it easy to rehydrate. Freeze drying samples stabilizes them for storage, preservation, or shipping . Many times, drying causes damage and some loss of cellular or protein activity. Lyophilization is a method of sample preservation that significantly reduces damage to biological samples. Substances that are not damaged by freezing can usually be lyophilized so that refrigerated storage is unnecessary. Important exceptions are mammalian cells, nearly all of which are destroyed by lyophilization. However, many microorganisms and proteins survive lyophilization well, and it is a preferred method of drying vaccines, pharmaceuticals, blood fractions, and other laboratory samples. Some specialist food products are also lyophilized.
Make: Virtis
Form/Manual: BT EL Lyophilizer Tabletop Service Form
Administrator:Sonja Young and Hyuk Kyu Seoh
Administrator Contact: ()
Application: Sublimation occurs when a frozen sample goes directly to the gaseous phase without passing through the liquid phase. As the ice sublimates, it leaves voids in the dry residual material making it easy to rehydrate. Freeze drying samples stabilizes them for storage, preservation, or shipping . Many times, drying causes damage and some loss of cellular or protein activity. Lyophilization is a method of sample preservation that significantly reduces damage to biological samples. Substances that are not damaged by freezing can usually be lyophilized so that refrigerated storage is unnecessary. Important exceptions are mammalian cells, nearly all of which are destroyed by lyophilization. However, many microorganisms and proteins survive lyophilization well, and it is a preferred method of drying vaccines, pharmaceuticals, blood fractions, and other laboratory samples. Some specialist food products are also lyophilized.
Make: LabConco
Form/Manual: Freezone Large Service Form
Administrator:Sonja Young and Hyuk Kyu Seoh
Administrator Contact: ()
Application: Sublimation occurs when a frozen sample goes directly to the gaseous phase without passing through the liquid phase. As the ice sublimates, it leaves voids in the dry residual material making it easy to rehydrate. Freeze drying samples stabilizes them for storage, preservation, or shipping . Many times, drying causes damage and some loss of cellular or protein activity. Lyophilization is a method of sample preservation that significantly reduces damage to biological samples. Substances that are not damaged by freezing can usually be lyophilized so that refrigerated storage is unnecessary. Important exceptions are mammalian cells, nearly all of which are destroyed by lyophilization. However, many microorganisms and proteins survive lyophilization well, and it is a preferred method of drying vaccines, pharmaceuticals, blood fractions, and other laboratory samples. Some specialist food products are also lyophilized.
Make: LabConco
Form/Manual: Freezone Large Service Form
Administrator:Sonja Young
Administrator Contact: ()
Application: Leveraging technologies adapted from the semiconductor industry, Affymetrix, the principle manufacture of GeneChip arrays uses photolithography and solid-phase chemistry to produce arrays containing hundreds of thousands of oligonucleotide probes packed at extremely high densities. The probes are designed to maximize sensitivity, specificity, and reproducibility, allowing consistent discrimination between specific and background signals, and between closely related target sequences.
Attesting to their powerful capabilities, GeneChip arrays are applied in a wide variety of DNA and mRNA analyses. Recent analytical accomplishments include the elucidation of interactions between signaling pathways involved in development, the discovery of a new class of leukemia, and the development of new assays to track drug metabolism.
Make: LabConco
Form/Manual: Freeze Dry System 4 Small Service Form
Administrator:Sonja Young and Hyuk Kyu Seoh
Administrator Contact: ()
Application: Leveraging technologies adapted from the semiconductor industry, Affymetrix, the principle manufacture of GeneChip arrays uses photolithography and solid-phase chemistry to produce arrays containing hundreds of thousands of oligonucleotide probes packed at extremely high densities. The probes are designed to maximize sensitivity, specificity, and reproducibility, allowing consistent discrimination between specific and background signals, and between closely related target sequences.
Attesting to their powerful capabilities, GeneChip arrays are applied in a wide variety of DNA and mRNA analyses. Recent analytical accomplishments include the elucidation of interactions between signaling pathways involved in development, the discovery of a new class of leukemia, and the development of new assays to track drug metabolism.
Make: LabConco
Form/Manual: Lyophilizer Small Service Form
Administrator: Sonja Young
Administrator Contact: ()
Application: Leveraging technologies adapted from the semiconductor industry, Affymetrix, the principle manufacture of GeneChip arrays uses photolithography and solid-phase chemistry to produce arrays containing hundreds of thousands of oligonucleotide probes packed at extremely high densities. The probes are designed to maximize sensitivity, specificity, and reproducibility, allowing consistent discrimination between specific and background signals, and between closely related target sequences.
Attesting to their powerful capabilities, GeneChip arrays are applied in a wide variety of DNA and mRNA analyses. Recent analytical accomplishments include the elucidation of interactions between signaling pathways involved in development, the discovery of a new class of leukemia, and the development of new assays to track drug metabolism.
Make: LabConco
Form/Manual: Lyophilizer Small with Dry Ice Tap Service Form
Administrator: Sonja Young
Administrator Contact: ()
Application: Model Gel Dryer allows the drying of acrylamide and other gel types.
The Model gel dryer has a 35 x 45 cm drying surface, which is large enough to fit up to 16 mini gels, 9 Criterion gels, 2 large format gels, or 1 sequencing gel.
Make: BioRad
Form/Manual:
Administrator:Sonja Young
Administrator Contact: ()
Application: Leveraging technologies adapted from the semiconductor industry, Affymetrix, the principle manufacture of GeneChip arrays uses photolithography and solid-phase chemistry to produce arrays containing hundreds of thousands of oligonucleotide probes packed at extremely high densities. The probes are designed to maximize sensitivity, specificity, and reproducibility, allowing consistent discrimination between specific and background signals, and between closely related target sequences.
Attesting to their powerful capabilities, GeneChip arrays are applied in a wide variety of DNA and mRNA analyses. Recent analytical accomplishments include the elucidation of interactions between signaling pathways involved in development, the discovery of a new class of leukemia, and the development of new assays to track drug metabolism.
Make: Affymetrix
For Use and Further Information: Genomics Microarray Services
Administrator:Sonja Young
Administrator Contact: ()
Application: The GeneChip® Fluidics Station is used for the wash and stain operation of Affymetrix GeneChip® arrays. The instrument includes design advancements to provide improved ease of use and true walk-away freedom dramatically improving efficiency in your genetic analysis.
Make: Affymetrix
For Use and Further Information: Genomics Microarray Services
Administrator:Sonja Young
Administrator Contact: ()
Application: GeneChip® Hybridization Oven provides uniform hybridization environmment for consistent RNA : chip bound DNA interactions, allowing for appropriate discrimination between specific and background signals, and between closely related target sequences.
Make: Affymetrix
For Use and Further Information: Genomics Microarray Services
Administrator: Chung Dar Lu and P.C. Tai
Administrator Contact: ()
Application: DNA Microarrays and Proteomic Technologies allow scientists to detect genes or proteins that are coregulated and whose patterns of change correlate with something important such as a disease state. However there is no assurance that these changes are really significant to the cell. Phenotype MicroArrays are a complementary technology providing the needed information at the cellular level and much more. After a genetic change or exposure to a drug lead, the researcher can directly evaluate the cellular response to that change. Phenotype MicroArrays can monitor, either directly or indirectly, most known aspects of cell function. The range of phenotypes includes:
• Cell surface structure and transport functions
• Catabolism of carbon, nitrogen, phosphorus, and sulfur
• Biosynthesis of small molecules
• Synthesis and function of macromolecules and cellular machinery
• Cellular respiratory functions
• Stress and repair functions
• Other cellular properties
Make: Biolog
Form/Manual: Biolog Phenotype Microarray
Administrator:Sonja Young
Administrator Contact: ()
Application: The popular GenePix® B Microarray Scanner has earned its outstanding reputation due to its incredible, intuitive, and reliable operation. Our commitment to engineering excellence guarantees that the GenePix B Microarray Scanner remains the benchmark in microarray scanning technology. In we updated the electronics to provide a state-of-the-art microarray scanner with the finest quality components while maintaining the features and performance that you have become accustomed to.
Make: Molecular Devices
Form/Manual: GenePix MicroArray Scanner
Administrator:Sonja Young
Administrator Contact: ()
Application: The Histocenter 3 embeds tissue samples into paraffin blocks for microtome sectioning.
Make: Shandon
Form/Manual: Histocentre 3
Administrator:Sonja Young
Application: The HM Microtome esnures that sectioning of paraffin blocks into extremely thin slices proceeds at an optimal sectioning temperature
Make: Fisher
Form/Manual: HM Microtome
Administrator:Sonja Young
Application: This microtome sections paraffin blocks into extremely thin slices using a sliding motion
Make: bilin.com.mx
Form/Manual: Microtome Model 86C Sliding
Administrator:Sonja Young
Administrator Contact: ()
Application: This microtome sections paraffin blocks into extremely thin slices using a sliding motion
Make: Unknown
Form/Manual: Rotory Microtome Service Form
Administrator:Ping Jiang
Administrator Contact:
Application: The Bioanalyzer provides for a rapid visualisation of sample quality and quantity. High sensitivity with minimal sample quantities. Significant time savings - up to12 samples in 30 minutes. Reduced use and waste of hazardous chemicals.
Make: Agilent
Form/Manual: Bioanalyzer
Administrator:Ping Jiang
Administrator Contact:
Application: The Qubit™ Fluorometer is the next generation of the popular benchtop fluorometer that accurately measures DNA, RNA, and protein using the highly sensitive Qubit quantitation assays. The concentration of the target molecule in the sample is reported by a fluorescent dye that emits a signal only when bound to to the target, which minimizes the effects of contaminants—including degraded DNA or RNA—on the result. The easy-to-use touch screen menus make it easy to select and run the assays you need, with results displayed in just a few seconds Key features of the Qubit Fluorometer include: Powerful, dual-core processor quickly and accurately quantifies DNA, RNA, and protein, in less than 5 seconds per sample Uses as little as 1 μL of sample Stores up to 1, sample results Large inch state-of-the-art color touch screen for easy workflow navigation Ability to personalize your Qubit Fluorometer with the assays you run most, add new assays, or even create your own with MyQubit
Make:Thermofisher
Form/Manual: Qubit 3 Fluorometer
Administrator:Hyuk-Kyu Seoh
Administrator Contact:
Application: Exceptional sensitivity for quantitation of biomolecules labeled with chemiluminescent probes Supports gel documentation of Coomassie™ blue and silver-stained samples. Accurate quantitation of closely spaced bands in complex protein samples for gels and films up to 18 x 12 cm. Low noise for longer exposure times and lower background, important for precise quantitation of very weak signals. Wide linear dynamic range for precise quantitation of faint and dark bands over four orders of magnitude in the same image, avoiding time-consuming multiple film exposures. Distortion, dark frame, and flat frame corrections are applied to each imaging mode for optimal precision and uniform quantitation. Sensitive detection of less than 40 pg of protein on a Western blot. Sensitivity may be increased by "binning" of up to 8 x 8 pixels and smoothing. Chemiluminescent and colorimetric signals can be captured in the same image without changing the lens.
Make: GE Healthcare
Form/Manual: LAS mini Chemiluminescence
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact:
Application: Amersham Imager is a sensitive and robust chemiluminescence imager for high-resolution digital imaging of protein and DNA samples in gels and membranes. Intuitive operation: You can operate the instrument from a tablet computer with easy-to-use image analysis software. No prior imager experience or training is required to obtain high-quality results. Excellent performance: Advanced optics provides high-resolution images, high sensitivity, and broad dynamic range. Robustness: An optimal instrument for multi-user labs.
Make: GE Healthcare
Form: LAS mini Chemiluminescence Service Form
Administrator:Sonja Young
Administrator Contact:
Application: Some applications on the Omega 10g are SYBR Green stained gels and GFP expressed experiments and Qdot multi-plexed western blots. The instrument has megapixel resolution, touch pad control panel, adjustable height sample tray, variable intensity UV Transilluminator and multi-wavelength LED Epi-Illumination.
Make: Ultra Lum
Form/Manual:Omega 10g
Administrator:"Sandy" Ying-Sin Hsieh
Administrator Contact:
Application: The Luminex MagPix System has been recently purchased (Summer'19). It belongs to a family of Flow cytometric systems enables you to multiplex (simultaneously measure) up to 50 analytes in a single microplate well, using very small samples. The MAGPIX system's imaging capapbility is based on a CCD technology that allows for it to be a more compact, robust system. It’s also easy to operate and maintain with streamlined start-up and shutdown protocols and minimal maintenance requirements, delivering fast and cost-effective bioassay results on many assay formats including nucleic acid assays, receptor-ligand assays, immunoassays, and enzymatic assays.
Make: Luminex
Form/Manual/website:MAGPIX System
Administrator: Sonja Young
Administrator Contact:
Application: Non-Fluorescent & Colorimetric Gels: Coomassie Blue, Silver stain, Autorad film, colony plates and Fluorescent Gels. This self-contained gel imaging system features a scientific grade megapixel CCD camera for capturing high resolution images with simple yet versatile capture and save options. Screen tilts to optimum viewing angle. A built-in computer touch screen supplies a complete system at one location for fluorescent and colorimetric imaging, while the attached comp.
NO ETHIDIUM BROMIDE is to be used in this instrument
Make: UVP
Form/Manual:UVP old EtBr OK Service Form
Administrator: Sonja Young
Administrator Contact:
Application: Non-Fluorescent & Colorimetric Gels: Coomassie Blue, Silver stain, Autorad film, colony plates and Fluorescent Gels. This self-contained gel imaging system features a scientific grade megapixel CCD camera for capturing high resolution images with simple yet versatile capture and save options. Screen tilts to optimum viewing angle. A built-in computer touch screen supplies a complete system at one location for fluorescent and colorimetric imaging.
Make: UVP
Form/Manual:UVP EtBr OK
Administrator: Sonja Young
Administrator Contact:
Application: Non-Fluorescent & Colorimetric Gels: Coomassie Blue, Silver stain, colony plates and Fluorescent Gels. InGenius3 is a self-contained, low budget gel documentation and analysis fluorescence applications. It features a compact darkroom which has a sliding front door and an internal LED white light. InGenius3 has a 3m pixel camera and can produce images with 16 bit image depth. A manual zoom lens and manual filter drawer (includes a UV filter) completes the package.
Make: Syngene
Form:UVP EtBr OK Service Form
Administrator: Hyuk-Kyu Seoh and "Sandy" Ying-Sin Hsieh
Administrator Contact: or
Application: The Typhoon is an older version fo the TyphoonTrio, and can image store phosphor autoradiography and many types of fluorescent stains (direct blue-excited fluorescence – and nm; direct green-excited fluorescence – nm; direct red-excited fluorescence – nm. This imager is specifically designed for 2-D DIGE multicolor scanning and detection of CyDye DIGE Fluor dye-labeled proteins. Other common fluorescent stains that this imagers can image are Deep Purple, Coomasie Blue, EtBr, SYPRO red and SYPRO Ruby. They can image agarose and acrylamide gels, blots, microarray slides and imaging plates of many different sizes.
Make: GE Healthcare
Form/Manual:Typhoon Phospho/ Fluorescent
Administrator: Sonja Young
Administrator Contact: ()
Application: Key RSDP Features of FluorChem Imaging System
• Resolution: Megapixel CCD resolution: Megapixels
• Proprietary algorithms for 3D image contour, image sharpening, and noise reduction for improved image resolution and quality.
• Sensitivity: Deep CCD peltier cooling facilitates multiple hour long exposures and exceptional image quality.
• FluorChem as an optimized for CCD imaging technology to generate femtogram sensitivity levels.
• Dynamic Range: > O.D. dynamic range with FluorChem Imaging System.
• Performance: Fast, easy, versatile, and powerful for comprehensive fluorescence and chemiluminescence applications AND basic gel documentation.
• Automatic lane/band detection and analysis with smiling corrections are easily done with a single button click!
• Capture grayscale or true color images with automatic RGB color image overlay feature.
Make: Bucher biotec
Form/Manual:Alpha Innotech Imaging Systems Manual
Administrator:Sonja Young
Administrator Contact: ()
Application: Culture and Cell Incubation
Make:Thermo-Fisher
Form/Manual:Incubator
Administrator: Sonja Young
Administrator Contact: ()
Application: The classic C25 incubator shakers are large capacity shakers utilizing an eccentric counter balanced drive to provide horizontal plane rotary motion in a 1" ( cm) circular orbit. Shaker speed and temperature are precisely regulated by a microprocessor controller that maintains setpoints within very rigid tolerances. Touch the keypad to select and display temperatures from a few degrees above ambient to 60º (Model C25), and 17º below ambient (minimum +4º) to 60º, (Model C25KC).
Make:New Brunswick
Form/Manual:Shaker, C25 Floor
Administrator: Sonja Young
Administrator Contact: ()
Application: The Series 25 incubator shakers are medium to large capacity shakers whose shaker speed and temperature are precisely regulated by a microprocessor controller that maintains setpoints within very rigid tolerances. Touch the keypad to select and display temperatures from a few degrees above ambient to 60º (Model Series 25), and 17º below ambient (minimum +4º) to 60º, (Model Series 25KC). NB. Even though this particular Shaker is well able to regulate it's temperature it NEEDS an additional thermometer to view temperature within the cabinet
Make:New Brunswick
Form/Manual:Shaker, Series 25 Floor
Administrator:Sonja Young
Administrator Contact: ()
Application: New Brunswick Floor Incubator Shakers E25R offers the largest capacity (flasks up to 6 L) in the Excella® line for shaking, incubating, and optional cooling. Choose from standard ambient models or refrigerated models that operate at 15°C below ambient to 60°C. The reliable microprocessor control system enables precise setting of speed, running time and temperature and automatically compensates for changes in load, voltage or temperature. - See more at: bilin.com.mx#bilin.com.mx
Make: New Brunswick
Form/Manual:Shaker, E25 Floor
Administrator: Sonja Young
Administrator Contact: ()
Application: The classic incubator shakers are large capacity shakers utilizing an eccentric counter balanced drive to provide horizontal plane rotary motion in a 1" ( cm) circular orbit. Shaker speed and temperature are precisely regulated by a microprocessor controller that maintains setpoints within very rigid tolerances. Touch the keypad to select and display temperatures from a few degrees above ambient to 60º (Model C25), and 17º below ambient (minimum +4º) to 60º, (Model C25KC).
Make:New Brunswick
Form/Manual:Shaker, Classic Floor
Administrator: Sonja Young and "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application:Thermo Scientific™ MaxQ shakers are versatile incubated/refrigerated units featuring a easy side access drain system making cleaning spills easy and retractable foot casters to easily position the shaker in the lab. MaxQ incubated and refrigerated floor shakers feature a foot pedal for hands-free operation and a large slanted viewing window to check the progress. These shakers are ideal for cell culture, solubility studies, plasmid purification, staining and destaining, extraction procedures, protein expression and many other applications
Make:Thermo Scientific
Form/Manual:Shaker, MaxQ Floor/Refrig Service Form
Administrator: Sonja Young
Administrator Contact: ()
Application: Large-capacity, environmental shakers for incubation and/or refrigeration.
• Wide temperature range
• Uniform temperature, regardless of sample location
• Rapid temperature equilibration
Make:New Brunswick
Form/Manual:Shaker, Innova Floor
Administrator: Sonja Young and "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: Features a heavy-duty drive and cool-running motor for long life and quiet operation under heavier loads and higher speeds.
Intuitive, spill-proof keypad allows easy input of parameters
in. (cm) LED display shows running conditions and diagnostics (all models except E1)
UniCentric™ drive and brushless DC motor ensure quiet, vibration-free operation
Versatile—use same accessories as other New Brunswick Scientific shakers
Two-year warranty on parts and labor (US and Canada only)
Make:New Brunswick
Form/Manual:Shaker C24 Tabletop
Administrator: Sonja Young and "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application:The E24 / E25 shakers combine incubated/refrigerated temperatures with orbital shaking in a compact footprint. They use minimal bench space and are affordably priced. These benchtop shakers are ideal for cell culture, solubility studies, extraction procedures, protein expression and many other applications
Make:New Brunswick
Form/Manual:Shaker E24 Tabletop
Administrator: Sonja Young and "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: Thermo Scientific™ MaxQ is a versatile, incubated and refrigerated shaker ideal for incubating a small number of vessels.
The MaxQ shakers combine incubated/refrigerated temperatures with orbital shaking in a compact footprint. They use minimal bench space and are affordably priced. These benchtop shakers are ideal for cell culture, solubility studies, extraction procedures, protein expression and many other applications
Make:Thermo Scientific
Form/Manual:Shaker MaxQ Tabletop
Administrator: Sonja Young
Administrator Contact: ()
Application: Thermo Scientific™ Mini is a versatile, incubated and refrigerated shaker ideal for incubating a small number of vessels. The Mini shakers combine incubated/refrigerated temperatures with orbital shaking in a compact footprint. They use minimal bench space and are affordably priced. These benchtop shakers are ideal for small cell culture, solubility studies, extraction procedures, protein expression and many other applications
Make:Thermo Scientific
Form/Manual:Mini Q Shaker Tabletop
Administrator: Sonja Young
Administrator Contact: ()
Application: Open air benchtop shakers are ideal for small cell culture, solubility studies, extraction procedures, protein expression and many other applications
Make:Thermo Scientific
Form/Manual:Rotating Shaker MaxQ
Administrator: Sonja Young
Administrator Contact: ()
Application: Sterilize glassware and other high temperatre needs
Make:Thermo-Fisher
Form/Manual:Oven Tabletop
Administrator: Sonja Young
Administrator Contact: ()
Application: Thermo-Fisher chamber furnaces are ideal for use in crowded laboratories and for common applications such as materials testing, burning, rapid heat processes.
Make:Thermo-Fisher
Form/Manual:
Administrator: "Sandy" Ying Sin Hsieh or John Houghton
Administrator Contact: () or ()
Application: The AFM is one of the foremost tools for imaging, measuring, and manipulating matter at the nanoscale. The information is gathered by "scanning" the surface on which the biological samples is based with a mechanical probe. Piezoelectric elements that facilitate tiny but accurate and precise movements on (electronic) command enable the very precise scanning. Electric potentials can also be scanned using conducting cantilevers. In this more advanced versions, currents can be passed through the tip to probe the electrical conductivity or transport of the underlying surface. There are various modes of scanning, which include:
•Contact Mode
•Non-Contact Mode
•Peak Force Mode (new to the VIII upgrade) which analyzes each tip-sample interaction to extract nanomechanical properties including modulus, adhesion, deformation, and dissipation.
Make: Bruker
For Use and Further Information:Atomic Force Microscope Services
Administrator: Bill Walthall
Administrator Contact: ()
Application: Deconvolution is a computationally intensive image processing technique that is being increasingly utilized for improving the contrast and resolution of digital images captured in the microscope. The foundations are based upon a suite of methods that are designed to remove or reverse the blurring present in microscope images induced by the limited aperture of the objective.
This upgrade using a new UNIX based OS, allows the user to image material in 4D at high resolution ( mm pixels). A CoolSnap HQ2 CCD camera allows the software to apply sophisticated algorithms to remove out of focus light and reassign refracted light to the calculated point of origin. The result is an image with a broad dynamic range of signal and stunning detail. The system is equipped with DIC optics, allowing the user to combine DIC and fluorescent light microscopy. The upgraded software is considerably more user friendly. 3D and 4D reconstructions are easier to setup and also has improved resolution. Possible applications include:
•High resolution imaging of cells and subcellular structure with multichannel detatil.
•Imaging of living cells over time.
•Detection and quantication of cell permeant, expressed, or injected fluorescent probes in living cells
•3D and 4D reconstructions
Make: DeltaVision
Form/Manual:Deltavision Website
Administrator: "Sandy" Ying Sin Hsieh or Liana Artinian
Administrator Contact: () or ()
Application: TILL Photonics Imaging system offers advanced equipment used for a variety of different applications studying dynamic processes in living cells such as:
•Measurement of rapidly changing intracellular ion concentrations (Ca2+, Na+ and other ions) e.g. in neurons.
•Study of signal transduction processes in response to e.g. growth factors or cytokines.
•Study of calcium sensitive processes.
•Simultaneous imaging of different target molecules within one sample using multiple staining with different dyes or probes.
•Metabolic transport.
•Cell-cell interactions.
Make:TILL Photonics
Form/Manual:TILL Photonics Imaging System Service Form
Administrator: Bill Walthall
Application: The Arturus Pixcell IIE laser capture microdissection system is specifcally designed around an olympus microscope for the isolation of specific cell types or tissue from tissues processed by paraffin embedding or cryo-sectioning. This microdisections permits the molecular analysis of pure populations of cells or specific regions of tissures. The system has a number of applications,
• Analysis of cell surface antigens and biomarkers
• Immunophenotyping of cells for stem cell and hematopoietic cell lineage studies
• Hematology
• Cell size and Cell Cycle studies
• Apoptosis, necrosis and live/dead cell assays
Make:Life Technologies (Arcturus)
Form/Manual:System Brochure
Administrator: John Houghton
Administrator Contact: ()
Application: Axio Imager 2 combines everything you've ever asked for in your research environment: brilliant optics and bright fluorescence. The contrast manager and light manager ensure defined conditions and reproducible results at all times. Use ACR to automatically detect and configure objectives and filter sets for Axio Imager.Z2
Make:Zeiss Axioimager 2
Form/Manual:Zeiss Axioimager 2
Administrator: John Houghton
Administrator Contact: ()
Application: The Axio Observer 2 inverted, automated fluorescent Microscope combines everything you've ever asked for in your research environment: brilliant optics and bright fluorescence. The contrast manager and light manager ensure defined conditions and reproducible results at all times. Use ACR to automatically detect and configure objectives and filter sets for Axio Observer.Z2
Make:Zeiss Axio Observer 2
Form/Manual:Zeiss Axioimager 2
Administrator: "Sandy" Ying Sin Hsieh and Hyuk Kyu Seoh
Administrator Contact:
Application: You can access pre-stored calculations such as ratios which provide double emission readout in a FRET-based or cell viability assay. You can run endpoint assays with one or two wavelengths or scan the entire wavelength range. You can also follow enzyme kinetics in real time.
Other applications: Enzyme kinetics - Temperature controlled reagent reservoirs with plate temperature control for stability and accuracy. Can be integrated with PerkinElmer automated liquid handling platforms; Cellular - Well area scanning. Can be integrated with PerkinElmer automated liquid handling platforms; Viable cell - Optional bottom reading offering signicant improvements for viable cell assays; ELISA - Photometric technology and AlphaLISA allow conversion to homogenous ELISA technology; GFP and other fluorescent proteins - Quad monochromators, bottom reading and well scanning; Luminescent Reporter gene and cell growth - Ultra-sensitive luminescence with dynamic range for low transfection rates; Calcium - dispenser for suspension cells convenient in receptor activation studies; Dual luciferase flash - enabled by dispenser option; Nucleis acid/protein quantitation - photometric technology.
Make: Perkin Elmer
Form/Manual:
Administrator: "Sandy" Ying-Sin Hsieh
Administrator Contact:
Application: VICTOR3 comes with several standard features such as temperature control, shaking, area scanning, adjustable measuring height, below fluorescence reading, dual label/ratio reading and kinetics. A dispenser is also available for cell-based assays by enabling fast kinetics measurements, enzyme assays and numerous other cellbased drug discovery assays.
Technologies and reading modes- Fluorescence Intensity (* nm)
• Fluorescence Polarization (* nm)
• Time-Resolved Fluorescence (TRF)
• Luminescence
• Glow, flash and dual luminescence
• Absorbance ( nm)
• UV Absorbance ( nm/ nm)
Make: PE
Form/Manual:Victor Plate Reader UV/Vis/Fluorescent
Administrator: Hyuk-Kyu Seoh
Administrator Contact:
Application:
•Powerful RDA features of GPS Explorer™ Software for flexible acquisition and data processing.
• Unmatched sensitivity (subfemtomole) in both MS and MS/SM modes
• Enhanced Precursor Ion Selection
• Profile biomolecules directly on tissue samples; sample (tissue section, whole organs or whole animals) can be analyzed directly, no extraction of compounds is required and no sample labeling required.
•ProteinPilot Software enables searching for over post-translational modifications, up to 45 work-up modifications and all amino acid substitutions, genetic variants and unexpected cleavages.
• Enhanced Mass accuracy. Using an internal standard, ppm mass accuracy is achieved, increasing confidence in protein ID.
• Quantitation of Specific proteins using iTRAQ reagents. iTRAQ reagents are multiplexed sets of 8 isobaric reagents which allows for sophisticated time course studies, absolute quantitation and monitors qualitative protein changes under different physiological conditions.
• Biomarker Discovery using iTRAQ reagents. Besides biomarker identification, iTRAQ allows quantitation that would indicate which proteins are changing in response to a given environmental change, drug treatment or disease.
• Post-source-decay for peptide sequencing. MALDI CID capability for protein sequence determination and structural analysis.
Make: ABI
For Use and Further Information:MALDI / Proteomic Services
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application:This technique sorts proteins according to two independent properties in 2 steps: the first-dimension step, isoelectric focusing (IEF), separates proteins according to their isoelectric points (pI); the second-dimension step, SDS-polyacrylamide gel electrophoresis (SDS-PAGE), separates proteins according to the molecular weights (MW). Each spot on the resulting two-dimensional array corresponds to a single protein species in the sample.
Make: GE Healthcare
Form/Manual:2D Gel Electrophoresis
Administrator: Hyuk-Kyu Seoh and "Sandy" Ying-Sin Hsieh
Administrator Contact: or
Application: The Typhoon Trio can image Storage phosphor autoradiography and many types of fluorescent stains (direct blue-excited fluorescence – and nm; direct green-excited fluorescence – nm; direct red-excited fluorescence – nm. This imager is specifically designed for 2-D DIGE multicolor scanning and detection of CyDye DIGE Fluor dye-labeled proteins. Other common fluorescent stains that this imagers can image are Deep Purple, Coomasie Blue, EtBr, SYPRO red and SYPRO Ruby. They can image agarose and acrylamide gels, blots, microarray slides and imaging plates of many different sizes.
Make: GE Healthcare
Form/Manual:Typhoon Trio Phospho, Fluorescent
Administrator: Hyuk-Kyu Seoh
Administrator Contact:
Application: Designed for use with most common 2-D gels. A protein pick-list is generated form 2D PAGE Gel, either automatically using predefined selection criteria, or manually. The protein pick-list is transferred to Ettan™ Spot Picker, which then automatically picks the protein spots according to the list. A wash step is performed after each picking session, and the location of each picked protein in its respective microplate well is automatically logged to facilitate sample tracking. When picking a limited number of protein spots, or for pooling of samples, the software also includes a “click-and-pick” function whereby proteins can be picked without a pick-list. The system accommodates any gel size up to - mm and picks from 1-mm as well as mm thick gels. respectively. Processing of 96 samples is performed in less than 30 min.
Make: GE Healthcare
Form/Manual:Spot Picker
Administrator: Hyuk-Kyu Seoh
Administrator Contact:
Application: Digester is a highly versatile instrument designed to perform in-gel digestion of proteins captured in 2-D gel electrophoresis spots. The instrument acts directly on Ettan™ Spot Picker output files, automatically tracking samples from spot picking to completed digestion using simple "plug-and-play" routines. It allows robust and reproducible digestion, sensitive to fmol range. Default digestion protocols are optimized and compatible with Coomassie™, silver, and fluorescence staining systems. A method editor also allows customization of methods. Standard microplates further increase ease-of-use, as do low-salt digestion buffers, eliminating the need for desalting (no need for C18 clean-up)
Make: GE Healthcare
Form/Manual:Digester Service Form
Administrator: "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: The Real-Time PCR Systems offer high performance, multicolor real-time PCR wherever your research takes you. Choose from our Fast and standard systems.
Real-time quantitative PCR has many applications including the precise measurement of changes in gene expression, pathogen detection, and post-PCR detection in allelic discrimination (SNPs) assays. It is also ideal for plus/minus assays to confirm the presence or absence of a pathogen, transgene, or other specific target sequence:
• well-format high-speed thermal cycling, delivering high quality results in less than 30 minutes
• Offers robust high resolution melting analysis
• Learn more about the Fast Real-Time PCR System
Make:Life Technologies
Form/Manual: Fast Operation Manual
Administrator: "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: StepOnePlus™ Real-Time PCR Systems offer intuitive software, Fast (<40 min) and standard (<2 hr) runs, and are configured for PC-free or networked operation. These factory-calibrated systems make it easy to step up to high-performance qPCR. And now these systems support high resolution melt (HRM) software
Make:Life Technologies
Form/Manual:StepOne Operation Manual
Administrator: "Sandy" Ying-Sin Hsieh
Administrator Contact: ()
Application: QuantStudio3™ Real-Time PCR Systems offer intuitive software, Fast (<40 min) and standard (<2 hr) runs, and are configured for PC-free or networked operation with intuitive software ineterface. These factory-calibrated systems make it easy to step up to high-performance qPCR using Applied Biosystems™ OptiFlex™ technology with white LED and 4 coupled channels enables optimal well-to-well and instrument-to-instrument accuracy.
Make:Life Technologies
Form/Manual:QuantStudio3 Operation Manual
Administrator: Ping Jiang
Administrator Contact:
Application: Biomek NX puts every aspect of liquid handling – including pipetting, dilution, dispensing, and integrations – into a single, automated system that is powerful and flexible. The NXP workstation offers multiple configurations, including multichannel, Biomek NX features Span-8 with gripper and can rotate a full °. The Span 8 is used for rapid plate-to-plate; tube to plate applications and assay miniaturization. Pipetting performance for low-volume reaction setup and assay miniaturization, as well as accurate and repeatable results extending into the submicroliter range. Applications
• DNA/RNA purification
• PCR setup and cleanup
• DNA Sequencing setup and cleanup
• Reproducible and high throughput for mutliple assays
Make: Beckman
Form/Manual:Biomek NX
Administrator: "Sandy" Ying-Sin Hsieh
Administrator Contact:
Application: The Biomek Laboratory Automated Workstation provides simple, intelligent automation of liquid-handling tasks. Pipetting, diluting and dispensing operations are performed quickly, easily and automatically. The modular platform allows expansion of system capability to include plate heating and cooling, plate washing, high-density transfers, photometric measurement.
These applications include:
Immunology: ELISA, EIA, RIA, Forensic Blood Typing.
Molecular Biology: DNA Sequencing, DNA Fingerprinting, PCR Processes, DNA Template Preparation, High-Density Library Maintenance and Screening, Sample Quantitation and Normalization, as well as Protein/enzymes Assays
Make: Life Technologies
Form/Manual:Biomek
Administrator: Sonja Young
Administrator Contact:
Application: The LS can count 3H, 14C, I, 35S and 32P. The instrument calculates counts per minute (cpm). Data can be normalized and blanks and/or backgrounds can be subtracted. You can set up a manual count or set up a User program with your specific needs (isotope and count time, for example). (LS Operator’s Manual).
Make: Beckman
Form/Manual:LS Scintillation Counter
Administrator:Sonja Young
Administrator Contact: ()
Application: 30 mm of solid lead provides effective shielding which gives constant background and minimal crosstalk. Multichannel analyer (MCA) technology incorporates a high resolution channel multichannel analyzer dedicated to each detector. It can count manually as well as automatically. With an energy range up to keV and a powerful set of software, Wizard gives you results from a wide range of applications including all RIA and IRMA tests, screening assays, etc. Ideal for chromium release studies - no crosstalk from samples on the conveyer means that the Wizard is ideal for working with higher energy isotopes such as Chromium; Vendor: Wallac
Make: Perkin Elmer
Form/Manual: Wizard Gamma
Administrator:Hyuk-Kyu-Seoh and "Sandy" Ying Sin Hsieh
Administrator Contact: ()
Application: The Frontier FTIR is powerful and adaptable range of Frontier™ IR systems and is assured to meet the needs of your current IR analysis. It can also be expanded to offer flexible system configurations in the near, near-mid, mid-far and far infrared regions, Frontier can support an extensive range of applications thanks to its superb sensitivity and configurability.
Chemical and Materials: From troubleshooting manufacturing problems, identifying product contaminants to gaining a deeper understanding of advanced material properties.
Research & Academia: Complete far-IR characterization of synthesized and novel materials, or quickly adapt the flexible platform for different research areas or groups
Make:Perkin Elmer
Form/Manual:Frontier_FTIR Brochure
Administrator:Ping Jiang and "Sandy" Ying Sin Hsieh
Administrator Contact: ()
Application: The Eppendorf Biophotometer® is a small, very compact spectrophotometer for measurements in the UV and VIS range. Spectra can be recorded and individual wavelength measurements can be made in a spectral range of nm to nm. What's more, the cuvette shaft of the Biophotometer kinetic is temperature controlled from +20°C to +42°C, meaning that enzyme and substrate kinetics can be measured directly in the device. No device upgrade with accessories is necessary for temperature bilin.com.mx Biophotometer fluorescence in addition to the Biophotometer basic has the option to determine very low concentrations of biomolecules using fluorescent dyes and can increase the measuring range by a factor of 1,, for detecting DNA for example.
Product characteristics:
• UV/Vis spectral range nm to nm
• Xenon flash lamp with very long service life
• Preprogrammed methods for a quick start
• Guided software process to minimize errors
Make:Eppendorf
Form/Manual:Biophotometer Operation Manual
Administrator:Ping Jiang and "Sandy" Ying Sin Hsieh
Administrator Contact: ()
Application: The BioPhotometer plus offers a compact UV/Vis photometer for use in molecular biology, biochemistry and cell biology and provides instant, out-of-the-box access to 32 routine methods, of which 9 methods are freely programmable,
e. g.:
• Measurement of DNA, RNA and protein concentration (UV and colorimetric)
• Incorporation rate of fluorescent molecules ( nm/ nm), e. g., for microarray experiments
• Enzymatic assays (e.g., peroxidase, alkaline phosphatase, β-galactosidase)
• Optical density of cells (OD )
Both measurement and calculation of results are performed at the press of a button, and the results of the analysis, as well as all accompanying data, are available at a glance. This guarantees safe, error-free operation and reliable results.
Make:Eppendorf
Form/Manual:Biophotometer Operation Manual
Administrator:Hyuk-Kyu Seoh
Administrator Contact: ()
Application: The Nanophotometer is an All-in-One spectrophotomer with micro volume ( ul) and optimized for quantification and purity assessment of nucleic acid and protein samples. Sample Compression Technology allows for accurate (+/- 5%) and reproducible ( Abs) readings of nucleic acids, proteins and peptides. This technology also is tolerant of a wide range of buffers that often interfere with an accurate reading. Funding provided by Tech fee.
Make: Implen
Form/Manual:Nanophotometer Operation Manual
Administrator:Ping Jiang and "Sandy" Ying Sin Hsieh
Administrator Contact: ()
Application: The NanoVue spectrophotometer is an easy-to-use and reliable instrument for the measurement of nucleic acid and protein samples. Samples of μl to 5 μl can be pipetted directly onto the gold-colored sample plate for measurement, and then simply recovered using a pipette. If sample recovery is not required, the sample plate can be quickly and easily wiped clean.
Make:GE Healthcare
Form/Manual:Nanovue Operation Manual
Administrator: "Sandy" Ying-Sin Hsieh and Sonja Young
Administrator Contact: ()
Application: The Mastercycler® family offers ultimate reliability combined with easy to use software. The universal block can work with all common consumables and increases the range of application flexibilities. The Mastercycler gradient has SteadySlope® technology ensuring optimal, constant heating and cooling rates, which means that results of gradient experiments can be transferred to routine applications.
Features:
• SteadySlope® and Triple Circuit Technology
• Gradient block1: up to 20°C gradient span is possible at any step of the PCR program
• Universal block2: Possible to use mL tubes, mL tubes or plates
• Simple programming for gradient function, adjustable ramp rates, time and temperature increments, incubation mode, link function, pause function
• Software-supported in situ Adapter
• RS and printer interface
• Auto-restart option in the event of a power failure
personal card system
Make: Eppendorf
Form/Manual:Mastercycler Gradient Service Form
Administrator:"Sandy" Ying-Sin Hsieh and Sonja Young
Administrator Contact: ()
Application: The Mastercycler® family offers ultimate reliability combined with easy to use software. The universal block can work with all common consumables and increases the range of application flexibilities. The Mastercycler gradient has SteadySlope® technology ensuring optimal, constant heating and cooling rates, which means that results of gradient experiments can be transferred to routine applications.
• Advantages of Mastercycler pro:
• Ultimate reduction of evaporation
• Extremely fast heating and cooling rates
• Gradient blocks with SteadySlope technology
• Intuitive graphic programming
• Display to indicate cycler number in a network
• Optional self-test of peltier elements
Make: Eppendorf
Form/Manual:Mastercycler Gradient Pro Service Form
Administrator: Sonja Young
Administrator Contact:
Application: Some of the separation Methods used in preparative ultracentrifugation:
Differential centrifugation: pelleting. Start with a uniform mixture of sample – molecules or organelles in buffer. Centrifuge to obtain pellet of heavier molecules, and supernatant.
Density gradient centrifugation: Rate zonal (also termed sedimentation velocity, zone centrifugation). Use a continuous density gradient of solvent such as sucrose. Density increases toward the bottom of tube. Sample is layered on top. Centrifuge until molecules form discrete bands depending upon their sedimentation values. Generally stop the run before any of the molecules reaches the bottom. % separation is possible with a small sample. Separates molecules based on size (MW). Used to separate various types of macromolecules – mixture of proteins; different types of RNA; separate DNA from RNA, or proteins; ribosomal subunits; polyribosomes.
Density gradient centrifugation: Isopycnic centrifugation (also termed sedimentation equilibrium centrifugation). Mix gradient material (such as cesium chloride- CsCl) with sample molecules. During the centrifugation, the CsCl generates a gradient (“self-generating gradient”), and the molecules move to the position in the gradient where their density is the same as the gradient material. Requires long centrifugation time to form a gradient ( hrs). Separates molecules based on their density – may have the same size. Often used to separate various types of DNA – circular vs linear, double stranded vs single stranded, DNA from RNA (RNA pellets), highly repetitive DNA (satellite DNA) from other DNA in the cell, can be used for separation of lipoproteins and cell organelles.
Make: Beckman
Form/Manual:Optima XLK Ultra Floor/a>
Administrator: Sonja Young
Administrator Contact: ()
Application: Differential centrifugation: pelleting. Start with a uniform mixture of sample – molecules or organelles in buffer. Centrifuge to obtain pellet of heavier molecules, and supernatant.
Density gradient centrifugation: Rate zonal (also termed sedimentation velocity, zone centrifugation). Use a continuous density gradient of solvent such as sucrose. Density increases toward the bottom of tube. Sample is layered on top. Centrifuge until molecules form discrete bands depending upon their sedimentation values. Generally stop the run before any of the molecules reaches the bottom. % separation is possible with a small sample. Separates molecules based on size (MW). Used to separate various types of macromolecules – mixture of proteins; different types of RNA; separate DNA from RNA, or proteins; ribosomal subunits; polyribosomes.
Density gradient centrifugation: Isopycnic centrifugation (also termed sedimentation equilibrium centrifugation). Mix gradient material (such as cesium chloride- CsCl) with sample molecules. During the centrifugation, the CsCl generates a gradient (“self-generating gradient”), and the molecules move to the position in the gradient where their density is the same as the gradient material. Requires long centrifugation time to form a gradient ( hrs). Separates molecules based on their density – may have the same size. Often used to separate various types of DNA – circular vs linear, double stranded vs single stranded, DNA from RNA (RNA pellets), highly repetitive DNA (satellite DNA) from other DNA in the cell, can be used for separation of lipoproteins and cell organelles.
Make: Beckman
Form/Manual:Optima MAX Ultra Tabletop
Administrator: Sonja Young
Administrator Contact: ()
Application: Differential centrifugation: pelleting. Start with a uniform mixture of sample – molecules or organelles in buffer. Centrifuge to obtain pellet of heavier molecules, and supernatant.
Density gradient centrifugation: Rate zonal (also termed sedimentation velocity, zone centrifugation). Use a continuous density gradient of solvent such as sucrose. Density increases toward the bottom of tube. Sample is layered on top. Centrifuge until molecules form discrete bands depending upon their sedimentation values. Generally stop the run before any of the molecules reaches the bottom. % separation is possible with a small sample. Separates molecules based on size (MW). Used to separate various types of macromolecules – mixture of proteins; different types of RNA; separate DNA from RNA, or proteins; ribosomal subunits; polyribosomes.
Density gradient centrifugation: Isopycnic centrifugation (also termed sedimentation equilibrium centrifugation). Mix gradient material (such as cesium chloride- CsCl) with sample molecules. During the centrifugation, the CsCl generates a gradient (“self-generating gradient”), and the molecules move to the position in the gradient where their density is the same as the gradient material. Requires long centrifugation time to form a gradient ( hrs). Separates molecules based on their density – may have the same size. Often used to separate various types of DNA – circular vs linear, double stranded vs single stranded, DNA from RNA (RNA pellets), highly repetitive DNA (satellite DNA) from other DNA in the cell, can be used for separation of lipoproteins and cell organelles.
Make: Beckman
Form/Manual:Optima MAX-XP Ultra Tabletop
Administrator: Sonja Young
Administrator Contact:()
Application: Some of the separation Methods used in preparative ultracentrifugation:
Differential centrifugation: pelleting. Start with a uniform mixture of sample – molecules or organelles in buffer. Centrifuge to obtain pellet of heavier molecules, and supernatant.
Despina Siolas,1,2,*Emily Vucic,3Emma Kurz,4Cristina Hajdu,5 and Dafna Bar-Sagi6,7,*
1Department of Medicine, New York University Grossman School of Medicine, New York, NY, USA
2Laura and Isaac Perlmutter Cancer Center, New York University Grossman School of Medicine, New York, NY, USA
Find articles by Despina Siolas
3Department of Biochemistry and Molecular Pharmacology, New York University Grossman School of Medicine, New York, NY, USA
Find articles by Emily Vucic
4Molecular Oncology and Tumor Immunology Training Program, NYU Grossman School of Medicine, New York, NY, USA
Find articles by Emma Kurz
5Department of Pathology, NYU Langone Health, New York, NY, USA
Find articles by Cristina Hajdu
6Department of Biochemistry and Molecular Pharmacology, New York University Grossman School of Medicine, New York, NY, USA
7Lead contact
Find articles by Dafna Bar-Sagi
Author informationCopyright and License informationDisclaimer
1Department of Medicine, New York University Grossman School of Medicine, New York, NY, USA
2Laura and Isaac Perlmutter Cancer Center, New York University Grossman School of Medicine, New York, NY, USA
3Department of Biochemistry and Molecular Pharmacology, New York University Grossman School of Medicine, New York, NY, USA
4Molecular Oncology and Tumor Immunology Training Program, NYU Grossman School of Medicine, New York, NY, USA
5Department of Pathology, NYU Langone Health, New York, NY, USA
6Department of Biochemistry and Molecular Pharmacology, New York University Grossman School of Medicine, New York, NY, USA
7Lead contact
AUTHOR CONTRIBUTIONS
The study was conceived and designed by D.S. and D.B.S. Investigations were conducted by D.S., E.K., E.V., and C.H. Bioinformatics analysis was carried out by E.V. The manuscript was written by D.S., E.V., and D.B.S., and all authors reviewed the paper.*Correspondence: bilin.com.mxluyn@bilin.com.mxd (D.S.), bilin.com.mxluyn@bilin.com.mx (D.B.-S.)
Copyright notice
The publisher's final edited version of this article is available free at Cell Rep
This paper analyzes existing, publicly available data. These accession numbers for the datasets are listed in the key resources table.
KEY RESOURCES TABLE
| REAGENT or RESOURCE Antibodies | SOURCE | IDENTIFIER |
|---|---|---|
| APC/Cy7 anti-mouse CD3 (17A2) | BioLegend | Cat# ; RRID:AB_ |
| BV CD45 (F11) | BioLegend | Cat# ; RRID:AB_ |
| PE anti-mouse F4/80 (BM8) | BioLegend | Cat# ; RRID:AB_ |
| PE anti-mouse Foxp3 (FJK s) | Invitrogen | Cat# ; RRID:AB_ |
| APC/Cy7 anti-mouse CD11b (M1/70) | BioLegend | Cat# ; RRID:AB_ |
| PE anti-mouse CD80 (A1) | BioLegend | Cat# ; RRID:AB_ |
| PerCP/Cy anti-mouse CTLA4 (UCB9) | BioLegend | Cat# ; RRID:AB_ |
| APC/Cy7 anti-mouse MHCII I-A/I-E (M5/) | BioLegend | Cat# ; RRID:AB_ |
| PE anti-mouse Gr1 (RBC5) | BioLegend | Cat# ; RRID:AB_ |
| APC anti-mouse Ly6G (1A8) | BioLegend | Cat# ; RRID:AB_ |
| APC anti-mouse CD (CC2) | BioLegend | Cat# ; RRID:AB_ |
| Mouse BD Fc Block (G2) | BD pharmingen | Cat# ; RRID:AB_ |
| PE mouse anti-mouse T-Bet (4B10) | BD pharmingen | Cat# ; RRID:AB_ |
| APC anti-mouse CD4 (GK) | BioLegend | Cat# ; RRID:AB_ |
| PE/Cy7 CD8 () | BioLegend | Cat# ; RRID:AB_ |
| PerCP/Cy anti-mouse CD8 () | BioLegend | Cat# ; RRID:AB_ |
| PerCP/Cy anti-mouse CD86 (GL-1) | BioLegend | Cat# ; RRID:AB_ |
| PerCP/Cy Ep-CAM (G) | BioLegend | Cat# ; RRID:AB_ |
| PerCP/Cy anti-mouse PD1 (29F.1A12) | BioLegend | Cat# ; RRID:AB_ |
| Pe/Cy7 anti-mouse IFN-g (XMG) | BioLegend | Cat# ; RRID:AB_ |
| PE anti-mouse CD31 () | BioLegend | Cat# ; RRID:AB_ |
| Pe/Cy7 anti-mouse PDGFRa (APA5) | BioLegend | Cat# ; RRID:AB_ |
| PE anti-mouse CD11c (N) | BioLegend | Cat# ; RRID:AB_ |
| PE IgG1k isotype control | Invitrogen | Cat# ; RRID:AB_ |
| Pe/Cy7 Rat IgG1 isotype control | BioLegend | Cat# ; RRID:AB_ |
| InVivo rat IgG2a mAb (2A3) isotype control | BioXCell | Cat# BE; RRID:AB_ |
| InVivoMAb monoclonal anti-mouse Ly6G (1A8) | BioXCell | Cat# BE; RRID:AB_ |
| InVivoMAb CD40 rat anti-mouse IgG2a mAb (FGK45) | BioXCell | Cat# BE; RRID:AB_ |
| InVivoMAb anti-rat Kappa Immunoglobulin Light Chain | BioXCell | Cat# BE; RRID:AB_ |
| APC anti-mouse CD34 (HM34) | BioLegend | Cat #; RRID:AB_ |
| MPO antibody | Santa Cruz | Cat# sc; RRID:AB_ |
| Neutrophil Marker (NIMP-R14) antibody | Santa Cruz | Cat# sc; RRID:AB_ |
| P53 (1C12) Mouse antibody | Cell Signaling | Cat# S; RRID:AB_ |
| Anti-Vinculin mouse antibody | SigmaAldrich | Cat# V; RRID:AB_ |
| Bacterial and virus strains | ||
| STBL3 | ThermoFisher | Cat# C |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Nab-paclitaxel | Celgene | Cat# |
| Gemcitabine | Hospira | Cat# |
| Albumin | Sigma Aldrich | Cat# A |
| Xtremegene 9 | Roche | Cat# 06 |
| Polybrene | Sigma Aldrich | Cat# TRG |
| Hygromycin | Sigma Aldrich | Cat# |
| G | Sigma Aldrich | Cat# |
| PfIFI | New England Biolabs | Cat# RS |
| BsmBI | New England Biolabs | Cat#RS |
| Shield-1 | Cheminpharma | Cat# S |
| Lipofectamine | Life Technologies | Cat# L |
| Critical commercial assays | ||
| Surveyor DNA mutation Kit | IDT | Cat# |
| TOPO TA Cloning Kit | Thermo-Fisher | Cat# KJ10 |
| SYBR Green PCR Master Mix | Thermo-Fisher | Cat# |
| Quantitect Reverse Transcription Kit | QIAGEN | Cat# |
| Zombie Green Fixable Viability Kit | Biolegend | Cat# |
| RNeasy Mini Kit | QIAGEN | Cat# |
| Milliplex Mouse Cytokine Magnetic Bead Panel | Millipore Sigma | Cat# MCYTOMAGK |
| KAPA Mouse Genotyping Kit | Roche | Cat# |
| Foxp3/Transcription Factor Staining Buffer Set | Invitrogen | Cat# |
| Experimental models: Cell lines | ||
| HEKT | ATCC | Cat# ATCC® CRL |
| KrasG12D/+;Trp53+/+PDEC | Pylayeva-Gupta et al., | N/A |
| KrasG12D/+;Trp53/ PDEC | This manuscript | N/A |
| KrasG12D/+;Trp53RH/+PDEC | This manuscript | N/A |
| Experimental models: Organisms/strains | ||
| C57Bl6/J mice females (weeks) | Charles River Laboratories | CR: |
| Oligonucleotides | ||
| p53 sgRNA, CGG AGC AGC GCT CAT GGT GG | This manuscript | N/A |
| p53 HDR template, CAC CTC CAG CTG GGA GCC GTG TCC GCG CCA TGG CCA TCT ACA AGA AGT CAC AGC ACA TGA CGG AAG TCG TGA GAC ACT GTC CCC ACC ATG AGC GCT GCT CCG ATG GTG ATG GTA AGC CCT CAA CAC CGC CTG TGG GGT TAG GAC TGG CAG | This manuscript | N/A |
| p53 Forward PCR primer, TGGGA CAGCCAAGTCTGTTA | This manuscript | N/A |
| p53 Reverse PCR primer CCTGCT GTCTCCAGACTCCT | This manuscript | N/A |
| shScramble CCGGTCCTAAGGTTA AGTCGCCCTCGCTCGAGCGAGGG CGACTTAACCTTAGGTTTT | Sarbassov et al., | Addgene Cat # |
| CXCL2 forward PCR primer ATGC CTGAAGACCCTGCCAAG | Roy et al., | N/A |
| CXCL2 reverse PCR primer GGTC AGTTAGCCTTGCCTTTG | Roy et al., | N/A |
| CXCL5 forward PCR primer ACAGT GCCCTACGGTGGAAGT | Roy et al., | N/A |
| CXCL5 reverse PCR primer CGAGT GCATTCCGCTTAGCTT | Roy et al., | N/A |
| Recombinant DNA | ||
| pLKO.1 neo | Gift from Sheila Stewart | Addgene Cat# |
| psPAX2 | Gift from Didier Trono | Addgene Cat# |
| pMD2G | Gift from Didier Trono | Addgene Cat# |
| pLKO.1 hygro | Gift from Bob Weinberg | Addgene Cat# |
| LentiCRISPRv2 hygro | Stringer et al., | Addgene Cat# |
| conditional EDCPV | Gift from R. Sordella, Cold Spring Harbor Laboratory | N/A |
| Software and algorithms | ||
| ImageJ | Schneider et al., | bilin.com.mx; RRID:SCR_ |
| FlowJo version | FlowJo | bilin.com.mx; RRID:SCR_ |
| R version | RStudio | bilin.com.mx; RRID:SCR_ |
| Prism Version 7 | GraphPad | bilin.com.mx; RRID:SCR_ |
| Vevo Lab | FUJIFILM-VisualSonics | bilin.com.mx |
| Other | ||
| Whole-Tissue Gene Expression Data of Pancreatic Ductal Adenocarcinoma | Badea et al., | GSE |
| Expression data from Mayo Clinic Pancreatic Tumor and Normal samples | Pei et al., | GSE |
Open in a separate window
All data reported in this paper will be shared by the lead contact upon request.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
Tumor genotype can influence the immune microenvironment, which plays a critical role in cancer development and therapy resistance. However, the immune effects of gain-of-function Trp53 mutations have not been defined in pancreatic cancer. We compare the immune profiles generated by KrasG12D-mutated mouse pancreatic ductal epithelial cells (PDECs) engineered genetically to express the Trp53RH mutation with their p53 wild-type control. KrasG12D/+;Trp53RH/+ tumors have a distinct immune profile characterized by an influx of CD11b+Ly6G+ neutrophils and concomitant decreases in CD3+ T cells, CD8+ T cells, and CD4+ T helper 1 cells. Knockdown of CXCL2, a neutrophil chemokine, in the tumor epithelial compartment of CRISPR KrasG12D/+;Trp53RH/+ PDEC tumors reverses the neutrophil phenotype. Neutrophil depletion of mice bearing CRISPR KrasG12D/+;Trp53RH/+ tumors augments sensitivity to combined CD40 immunotherapy and chemotherapy. These data link Trp53RH to the presence of intratumoral neutrophils in pancreatic cancer and suggest that tumor genotypes could inform selection of affected individuals for immunotherapy.
Siolas et al. demonstrate that the gain-offunction Trp53RH mutation promotes CD11b+Ly6G+ neutrophil recruitment to KrasG12D pancreatic tumors, which is distinct from tumors with loss-of-function or wild-type Trp53. The presence of neutrophils in the tumor microenvironment promotes resistance to combination CD40 immunotherapy and chemotherapy treatment, suggesting that tumor genotype may guide therapy selection.
Pancreatic ductal adenocarcinoma (PDAC) is an intractable disease with a low survival rate, limited treatment options, and a poor therapy response rate (Raj et al., ). This is in part due to the immunosuppressive and fibrotic microenvironment of pancreatic tumors (Murakami et al., ). PDAC progression is typified by a multitude of immunosuppressive cells, including regulatory T cells, myeloid-derived suppressor cells (MDSCs), neutrophils, and tumor-associated macrophages (TAMs), leading to immune evasion (Hiraoka et al., ; Ho et al., ; Lesina et al., ; Steele et al., ). There is an urgent need to increase our understanding of how tumors create an immunosuppressive microenvironment that leads to tumor growth and therapy resistance (Martinez-Bosch et al., ).
Different tumor genetic backgrounds can profoundly influence the composition of the immune microenvironment, as demonstrated in melanoma, breast, and prostate cancers, through distinct cellular mechanisms (Bezzi et al., ; Spranger et al., ; Wellenstein et al., ). For example, activation of ²-catenin signaling in melanoma cells leads to T cell exclusion and resistance to checkpoint immunotherapy in genetically engineered mouse models (GEMMs) (Spranger et al., ). In prostate cancer GEMMs, loss of the tumor suppressor gene Pten alone or in combination with loss of Trp53, Zbtb7a, or Pml resulted in diverse immune profiles affecting MDSCs, monocytes, and T cells (Bezzi et al., ). Although changes to the immune microenvironment over time have been described during development of pancreatic cancer, how distinct immune cell populations correlate to specific tumor genotypes has not been determined (Clark et al., ).
In PDAC, KRAS mutations are an initiating genetic event and the most frequent gene alteration, occurring in over 90% of tumors (Raphael et al., ). Several labs have demonstrated that KRASG12D mutations in tumor cells remodel the pancreatic immune microenvironment by recruiting immunosuppressive MDSCs and regulatory T cells (Bayne et al., ; Mathew et al., ; Pylayeva-Gupta et al., ; Zhang et al., ), but the effects of additional mutations have not been explored.
TP53 is mutated in up to 70% of PDACs, second in mutation frequency only to KRAS (Raphael et al., ). Homozygous TP53 deletions, found in less than 2% of tumors, are a much rarer genetic event than p53 mutation in human PDAC (Raphael et al., ). Trp53 deletions occurring in the context of oncogenic Kras mutations have been demonstrated experimentally to drive recruitment of CD11b+F+ macrophages in autochthonous pancreatic tumor models through increased expression of CXCR3and CCR2-associated chemokines and macrophage colony-stimulating factor (M-CSF) (Blagih et al., ). However, most alterations affecting TP53 in human PDAC are missense mutations affecting the DNA-binding domain, which may be gain-of-function mutations that bestow neomorphic capabilities or loss-of-function mutations that abrogate its tumor suppressor activity (Pfister and Prives, ).
An integrated genomics analysis of human PDACs defined four subtypes of pancreatic cancer (Bailey et al., ). In particular, the squamous subtype is correlated with TP53 mutations and has been observed to be enriched for a distinct immune cell-specific gene expression signature (Bailey et al., ). A separate study found that the human PDAC squamous subtype was enriched significantly for infiltration of tumor-associated neutrophils, suggesting a connection between TP53 mutations and neutrophils (Chao et al., ). In addition, tumors from KrasG12D;Trp53RH;Cxcr2/ - GEMM mice, whose intratumoral neutrophil recruitment is abrogated because of deletion of the CXCR2 receptor, had decreased expression of genes associated with the PDAC squamous subtype compared with controls (Chao et al., ; Steele et al., ). Neutrophil presence (Chao et al., ; Steele et al., ) and Trp53RH gain-of-function mutation in tumor cells (Morton et al., ; Weissmueller et al., ) have been implicated independently in promoting metastasis in mouse models of PDAC. Although these studies implicate the Trp53RH mutation in mediating immune regulation, the immune effects directly attributable to acquisition of the gain-of-function Trp53RH mutation in pancreatic ductal epithelial cells have not been characterized.
Here we used CRISPR-Cas9 to engineer a Trp53RH mutation in primary murine pancreatic ductal epithelial cells (PDECs) derived from genetically engineered KrasG12D mice. Orthotopic implantation of these cell lines into wild-type immunocompetent C57BL/6 mice revealed that CRISPR KrasG12D/+;Trp53RH/+ PDEC tumors have a distinct immune profile characterized by an increase in intratumoral neutrophils and a concomitant decrease in T cells compared with KrasG12D/+;Trp53+/+ lesions. Correspondingly, CRISPR KrasG12D/+;Trp53RH/+ PDEC tumor epithelial cells produced elevated levels of two chemokines involved in neutrophil accumulation, CXCL2 and CXCL5, but only knockdown of CXCL2 in CRISPR KrasG12D/+;Trp53RH/+ PDEC tumors abrogated neutrophil recruitment. Finally, depletion of neutrophils from CRISPR KrasG12D/+;Trp53RH/+ PDEC tumors augmented sensitivity to CD40 agonist combination chemotherapy and immunotherapy. These results support a role of the intratumoral Trp53RH mutation in modulating the tumor microenvironment in pancreatic cancer and mediating therapeutic response to immunotherapy.
To understand the potential connection between the immune microenvironment and gain-of-function mutant Trp53RH, we used PDECs obtained from KrasG12D/+;Trp53+/+ GEMMs. Because these can be cultivated ex vivo (Pylayeva-Gupta et al., ), they are amenable to genetic targeting, allowing us to focus selectively on Trp We targeted the most common TP53 mutation in human pancreatic cancer, RH (Bailey et al., ; Witkiewicz et al., ), which is the equivalent of mouse RH. To create isogenic PDEC lines with a defined Trp53 mutation while minimizing off-target effects, we selected a conditional CRISPR-Cas9 gene editing platform in which a FKBPderived destabilizing domain is fused to Cas9 (DD-Cas9), enabling conditional Cas9 expression and temporal control of gene editing in the presence of an FKBP12 small-molecule synthetic ligand, Shield-1 (Senturk et al., ). Following genetic sequence verification, CRISPR KrasG12D/+;Trp53+/+ or KrasG12D/+;Trp53RH/+ cells were implanted orthotopically into the pancreata of wild-type mice, and tumors that formed were harvested 2 weeks later (Figure 1A). Compared with KrasG12D/+;Trp53+/+ tumors, CRISPR KrasG12D/+;Trp53RH/+ tumors had a higher tumor volume and weight (Figure 1B) and displayed more aggressive histological features, including a complex architecture consisting of poor gland formation, predominantly solid tumor growth, and abundant neutrophilic inflammatory infiltrates (Figure 1C), indicating that the edited Trp53RH mutation promoted neoplastic progression.
Open in a separate window
Figure 1.
(A) Experimental design. Representative gross tumors are shown.
(B) Tumor weight. Each dot represents one mouse. n = 6. Error bars, ± SD.
(C) Representative images of tumor sections stained by HE; scale bars, ¼m.
(D) mRNA transcript levels as measured by qPCR. The graph shows quantification of the ratio of transcripts for doxorubicin-treated versus untreated cells. Error bars, ± SEM.
(E) Left: representative images of tumor sections stained for CK19, Ki, and DAPI by immunofluorescence. Scale bars, ¼m. Right: Ki quantification per field of view. Each point on the graph represents one mouse; n = 5 (KrasG12D/+; Trp53RH/+), n = 4 (KrasG12D/+;Trp53+/+). Error bars, ± SD.
For (B), (D), and (E), Students t test (two-tailed, unpaired); *p , **p , ****p
Next we sought to confirm the functionality of mutant Trp53RH in CRISPR-Cas9-modified cells by examining the expression of well-established target genes of Trp53RH. Specifically, we chose to focus on the Ccna, Ccnb1, Ccnb2, and Cdk1 cell cycle control genes, whose expression has been shown to increase after DNA damage through Trp53RHdependent activation of nuclear transcription factor Y (NF-Y) (Di Agostino et al., ). Exposure of CRISPR-Cas9-modified cells to the DNA-damaging agent doxorubicin was accompanied by higher expression of Ccna, Ccnb1, Ccnb2, and Cdk1 in CRISPR KrasG12D/+;Trp53RH/+ cells in comparison with KrasG12D/+;Trp53+/+ cells (Figure 1D), consistent with the gain-of-function mode of action attributed to this mutation. In addition, CRISPR KrasG12D/+;Trp53RH/+ tumors displayed higher proliferative rates compared with KrasG12D/+;Trp53+/+ tumors, as determined by epithelium-associated Ki staining (Figure 1E). Our analyses demonstrate the feasibility of introducing a Trp53RH gain-of-function mutation using a conditionally active CRISPR-Cas9 system and the utility of this approach for creation of an isogenic model system to pursue Trp53RH functional studies.
To assess the immune landscape of gain-of-function mutant Trp53RH tumors, we performed immune profiling of mouse orthotopic tumors using multicolor flow cytometry 2 weeks after implantation. CRISPR KrasG12D/+;Trp53RH/+ tumors displayed a significantly elevated proportion of tumor-associated neutrophils (CD11b+Ly6G+) in comparison with KrasG12D/+;Trp53+/+ lesions (Figure 2A). This was confirmed by immunohistochemistry (IHC) analysis (Figure S1A) and remains significant when accounting for tumor weight (Figure S1B). The infiltration of neutrophils is in contrast to the lack of observed changes in other cells of myeloid lineage, including TAMs (CD11b+F+), M1 (F+MHCII+CD80+CD86+) or M2 (F+MHCIICD+) macrophages (Figures 2B2D), CD11c+ dendritic cells, or CD11c+major histocompatibility complex (MHC) class II+ classical dendritic cells (Figures S1C and S1D).
Open in a separate window
Figure 2.
(AG) Flow cytometric plots and quantification of (A) neutrophils, (B) TAMs, (C) M1 macrophages, (D) M2 macrophages, (E) CD3+ T cells, (F) T helper cells and CD8+ T cells, and (G) Th1 cells. n = 68; error bars, ± SD. Students t test (two-tailed, unpaired). **p , ****p ; n.s., not significant.
(H) Flow cytometry plots (left) and quantification (right) of neutrophils from orthotopically implanted CRISPR KrasG12D/+;Trp53+/+ tumors or CRISPR KrasG12D/+; Trp53/ tumors. n = 8; error bars, ± SD. Students t test (two-tailed, unpaired).
(I) Gene Ontology analysis of the human TCGA PDAC cohort for genes differentially expressed with p in p53 wild-type (n = 63) compared with p53 mutant tumors (n = 58), highlighting the top significantly altered immune related pathways. See also Figures S1S3.
Examination of the T cell compartment in CRISPR-generated tumors by flow cytometry demonstrated decreases in CD3+ T cells, CD8+ T cells, and Th1 helper cells (CD4+Tbet+) in CRISPR KrasG12D/+;Trp53RH/+ tumors, but there were no changes in CD4+ T cells (Figures 2E2G). The observed changes in the T cell compartment are consistent with published reports demonstrating an inverse relationship between neutrophil accumulation and T cell infiltration in pancreatic cancer (Chao et al., ; Steele et al., ). There were no observed changes in CD4+Foxp3+ regulatory T cells or PD1+ CD8+ T cells (Figures S1E and S1F). All flow cytometry analyses were carried out using three independent sequence-verified CRISPR-Cas9-modified clones from each genotype (Figures S2AS2H). No significant inter-clonal variations were observed, ruling out the possibility that the observed immune profiles are clone dependent. Furthermore, immunofluorescence detection of neutrophils in pancreatic tumors derived from mouse models of autochthonous PDAC driven by a pancreas-specific G12D mutation in KRAS that carried wildtype p53 (KC model: KrasLSL-G12D/+; Trp53+/+;p48Cre/+) or the pancreas-specific RH mutation in p53 (KPC model: KrasLSL-G12D/+;Trp53LSL-RH/+;p48Cre/+) revealed a significantly higher neutrophil density number, as indicated by the higher number of myeloperoxidase (MPO+) cells in KPC tumors compared with KC tumors (Figure S3A). These data suggest that acquisition of the gain-of-function Trp53RH mutation leads to intratumoral neutrophil accumulation. To examine whether this immune phenotype is specific to the Trp53RH mutation, we used CRISPR-Cas9 gene editing to create a homozygous p53 deletion in our KrasG12D/+;Trp53+/+ PDECs (Figure S3B). CRISPR KrasG12D/+;Trp53/ orthotopic tumors did not display an increase in intratumoral neutrophil accumulation compared with CRISPR KrasG12D/+;Trp53+/+ tumors (Figure 2H; Figure S3C), indicating that the Trp53RH mutation exerts a distinct immune phenotype to the tumor microenvironment.
To further explore this observation, we examined the human pancreatic adenocarcinoma cohort from The Cancer Genome Atlas (TCGA) for genes significantly differentially expressed (p ) between tumors with missense mutations in the DNA binding domain of TP53 compared with tumors with wild-type TP Highly frequent hotspot missense mutations located in the p53 DNA binding domain are a key feature of gain-of-function activity (Bargonetti and Prives, ). Although multiple metabolic pathways associated with mutant TP53 function (Alvarado-Ortiz et al., ; Liu et al., ) were highly upregulated by Gene Ontology analysis in the mutated PDAC tumors, neutrophil-related pathways, including neutrophil-mediated immunity, neutrophil activation, and neutrophil degranulation, were also enriched significantly (Figure 2I). Because of the strong association between purported gain-of-function p53 mutations and neutrophils in pancreatic cancer in humans and mice, we focused on the mechanism of neutrophil infiltration in Trp53RH tumors.
Neutrophil recruitment is mainly mediated by chemokines that have a glutamate-leucine-arginine motif (ELR+ chemokines), which consist primarily of CXCL1, CXCL2, and CXCL5 (Disteldorf et al., ). CXCR2, a G-protein-coupled receptor, regulates neutrophil migration through these chemokines (Jaffer and Ma, ). Human PDAC tumors display increased expression of CXCL2 and CXCL5 in comparison with normal pancreas (Figure 3A), suggesting that production of these chemokines may be responsible for intratumoral neutrophil accumulation. To assess the relevance of this recruitment mechanism to the infiltration of neutrophils observed in CRISPR KrasG12D/+; Trp53RH/+ tumors, we analyzed the relative levels of CXCL2 and CXCL5 production by quantitative PCR (qPCR) in tumor epithelial cells (CD45PDGFRCD34EPCAM+ epithelium) and CD45+ intratumoral immune cells isolated by flow cytometry from CRISPR KrasG12D/+;Trp53RH/+or KrasG12D/+;Trp53+/+ tumors. The epithelial compartment of CRISPR KrasG12D/+; Trp53RH/+ tumors displayed significantly higher levels of Cxcl2 and Cxcl5 expression than the epithelial compartment of CRISPR KrasG12D/+;Trp53+/+ tumors (Figure 3B). Enhanced production of the CXCL2 and CXCL5 chemokines in the CRISPR KrasG12D/+;Trp53RH/+ tumors in comparison to KrasG12D/+; Trp53+/+ was confirmed using mouse chemokine magnetic bead multiplex immunoassay (Figure S3D). Focusing on CRISPR KrasG12D/+;Trp53RH/+ tumors, we found that CXCL5 expression was significantly higher in tumor epithelial cells than in the immune cell compartment, whereas the reverse was true for CXCL2 expression (Figure S3E). High levels of CXCL2 in the microenvironment are not unexpected because neutrophils can express abundant CXCL2 to amplify neutrophil recruitment and activation in an autocrine and/or paracrine manner (Li et al., ).
Open in a separate window
Figure 3.
(A) mRNA transcript levels in PDACs compared with normal adjacent tissue (n = 75 PDACs and n = 55 adjacent normal cells). Each data point indicates an individual tissue sample. Error bars, ± SD.
(B) mRNA expression levels as measured by qPCR. Error bars, ± SEM; n = 3 using pooled samples of 5 tumors each.
(C) mRNA expression levels in vitro measured by qPCR. Error bars, ± SEM; n = 34.
(D) Gross histology (top) and graph of tumor weight (bottom, in milligrams) from CRISPR KrasG12D/+;Trp53RH/+ tumors stably expressing scramble shRNA (shScr) and shRNA specific for CXCL5 (shCXCL5) or CXCL2 (shCXCL2). Error bars, ± SD.
(EJ) Representative flow cytometry plots and quantification of (E) neutrophils, (F) CD3+ T cells, (G) T helper cells, (H) CD8+ T cells, (I) Th1 cells, and (J) regulatory T cells. Each dot represents one mouse. Error bars, ± SD. For (A)(J), Students t test (two-tailed, unpaired); *p , **p , ***p ****p See also Figure S3.
To examine whether intratumoral neutrophil accumulation is mediated by chemokines generated by tumor epithelial cells, we stably transfected short hairpin RNAs (shRNAs) targeting CXCL2 or CXCL5 or a scramble hairpin control into CRISPR KrasG12D/+;Trp53RH/+ cells. These hairpins induced more than 80% knockdown efficiency, as assessed by qPCR of in vitro mRNA (Figure 3C). Two weeks after orthotopic implantation, CRISPR KrasG12D/+;Trp53RH/+ tumors with a CXCL2 or CXCL5 hairpin were smaller in size (Figure 3D), consistent with published reports showing that these chemokines affect tumor growth (Keeley et al., ; Zhao et al., ). Furthermore, CRISPR KrasG12D/+;Trp53RH/+ tumors bearing a CXCL2 hairpin showed fewer intratumoral neutrophils than tumors bearing a scramble control hairpin (Figure 3E). Flow cytometry analysis of CRISPR KrasG12D/+;Trp53RH/+ shCXCL2 tumors demonstrated a greater abundance of CD3+, CD4+, and CD8+ T cells compared to scramble hairpin control tumors (Figures 3F3H). Further examination of the CD4 compartment in CRISPR KrasG12D/+;Trp53RH/+shCXCL2 tumors revealed a significant increase in the CD4+Tbet+ Th1 population and a slight decrease in the CD4+Foxp3+ regulatory T cell population (Figures 3I and 3J). In contrast, no significant difference in neutrophil accumulation was detected in CRISPR KrasG12D/+; Trp53RH/+ tumors stably expressing shCXCL5 (Figure 3E). These results implicate tumor-cell-derived CXCL2 production in mediating the neutrophil immune phenotype of CRISPR KrasG12D/+;Trp53RH/+ tumors. Analysis of the peripheral blood of mice bearing orthotopic CRISPR KrasG12D/+;Trp53RH/+ tumors or KrasG12D/+;Trp53+/+ tumors revealed no significant difference in the abundance of neutrophils between the two tumor genotypes, ruling out a potential contribution of systemic neutrophilia (Figure S3F).
The combination of agonist CD40 immunotherapy with gemcitabine and nab-paclitaxel chemotherapy is currently in phase II clinical trials for treatment of pancreatic cancer. Treatment with a CD40 antibody activates antigen-presenting cells (APCs) that can elicit an immune response from T cells using tumor antigens released by chemotherapy-mediated cell destruction (Byrne and Vonderheide, ). Because neutrophils may interfere with T cell proliferation and function as well as differentiation and maturation of APCs (Li et al., ; Schuster et al., ), we hypothesized that neutrophils may cause resistance to CD40 combination therapy. We treated mice bearing orthotopic CRISPR KrasG12D/+; Trp53+/+ tumors or CRISPR KrasG12D/+;Trp53RH/+ tumors with a single dose of gemcitabine and nab-paclitaxel, followed by one dose of mouse CD40 (FGK45) 48 h later, as established in prior publications (Byrne and Vonderheide, ). Tumors were harvested 4 weeks after the drug treatment (Figure S4A). CRISPR KrasG12D/+;Trp53RH/+tumors were more resistant to CD40 combination treatment than CRISPR KrasG12D/+;Trp53+/+ tumors, as measured by tumor weight (Figure S4B).
To determine whether neutrophils are a source of resistance to this drug combination, we used a neutrophil depletion strategy in mice bearing CRISPR KrasG12D/+;Trp53RH/+ tumors. The anti-Ly6G antibody 1A8 is an established means for successfully depleting Ly6G+ cells in vivo (Boivin et al., ; Jamieson et al., ; Steele et al., ), and we confirmed the efficiency of intratumoral neutrophil depletion in our mouse model using flow cytometry (Figure S4C). CRISPR KrasG12D/+; Trp53RH/+ tumor-bearing mice were treated continuously with anti-Ly6G or control antibody every 48 h in addition to a single treatment of combination CD40 immunotherapy and gemcitabine and nab-paclitaxel chemotherapy commencing 2 weeks after orthotopic implantation (Figure 4A). CD40 combination treatment was more effective in slowing tumor growth when administered together with anti-Ly6G compared with the control antibody combination (Figures 4B and 4C). Examination of intratumoral lymphocytes from CD40 combination immunotherapy/chemotherapy-treated tumors by flow cytometry 2 weeks after drug treatment revealed significant increases in CD3+, CD4+, and CD8+ cells in neutrophil-depleted mice compared with control mice (Figures 4D4F). Although there was no difference in PD1+CD8+ T cells, a marker of T cell exhaustion, or in CD4+Foxp3+ regulatory T cells (Figures S4D and S4E), we observed an increase in CD4+Tbet+ Th1 cells (Figure 4G) in tumors treated with CD40 combination immunotherapy and the Ly6G antibody in comparison with mice treated with combination immunotherapy and a control antibody. These results support a model where the gain-of-function Trp53RH mutation promotes neutrophil infiltration, which, in turn, could confer resistance to immunotherapy combination drug treatment.
Open in a separate window
Figure 4.
(A) Experimental design.
(B and C) Tumor growth curves (B) and waterfall plots (C) for 21 days after the start of the indicated therapy (n = 910 mice/group). Each symbol or bar represents the mean of a group (B) or a single mouse (C), respectively, with error bars indicating SEM. Statistical differences were determined by linear mixed-effects modeling with Tukeys honest significance (HSD) post-test (B) with significance indicated. **p , ***p
(DG) Representative flow cytometry plots and quantification of (D) CD3+ T cells, (E) CD8+ T cells, (F) T helper cells, and (G) Th1 cells. Each dot represents one mouse; n = 89. Error bars, ± SD. Students t test (two-tailed, unpaired). *p , **p , ****p See also Figure S4.
Increasing evidence suggests that oncogenic drivers can coordinate with different secondary mutations to create diverse immune landscapes (Bezzi et al., ). Loss of p53 expression can cooperate with oncogenic KRAS to promote tumor development through the presence of CD11b+F+ macrophages (Blagih et al., ), and our work indicates a neutrophil-rich predominance when KRASG12D tumors acquire a gain-of-function p53 mutation, suggesting that shifts in the predominant myeloid population may occur based on secondary mutations. In non small cell lung cancer (NSCLC) mouse models, KRasG12D and MYC cooperate to induce CCL9-mediated recruitment of CD+ macrophages and PD-L1-dependent expulsion of T cells (Kortlever et al., ). In contrast, STK11/LKB1 loss cooperates with KRasG12D to promote intratumoral accumulation of neutrophils in NSCLC (Koyama et al., ), indicating that secondary mutations may refine the composition of intratumoral immune populations and that different immune profiles may occur within the same cancer type. Although tumor genotype is not currently utilized for selecting individuals for immunotherapy, with the exception of those with high mutational burden being considered for treatment with PD1 therapy (Marabelle et al., ), our study adds to the mounting evidence that suggests that affected individuals may be stratified for clinical trials based on their genotype and/or immunophenotype to tailor precision therapy (Bezzi et al., ).
There are several possible mechanisms whereby p53 mutation might mediate an increase in ELR+ chemokines. Increased transcription of CXCL5 has been found to be dependent on gain-of function mutant p53 in multiple cancer cell lines, including lung, breast, and melanoma (Yeudall et al., ). In addition, there are several studies suggesting that the p53RH mutation may elevate CXC chemokine production through nuclear factor kB (NF-kB). Mutant Trp53RH is a well-established activator of NF-kB (Cooks et al., ; Weisz et al., ), and examination of the KPC mouse model revealed that NF-kB activation can potently increase CXCL5 levels (Chao et al., ). In addition, an analysis of the pancreatic cancer TCGA dataset demonstrated that tumors with high CXCR2 ligand expression were enriched significantly in expression of genes associated with inflammatory signaling pathways involving NF-kB (Chao et al., ). However, the mechanism by which p53 mutations can influence ELR+ chemokine expression may also depend on tumor tissue type. Most recently, a separate study examining Trp53RH mutant osteosarcoma cell lines demonstrated an increase in CXCL5-mediated by PLAC8 (ONZIN) overexpression (Zhang et al., ). PLAC8 is a small cysteine-rich protein that is strongly expressed in human invasive PDAC and is involved in pancreatic cell growth and progression, but its relationship to neutrophil chemokines has not been defined (Kaistha et al., ).
It has been proposed that neutrophils can be pro- or antitumorigenic depending in part on the specific cancer type and stage (Jaillon et al., ). Efforts have been made to classify neutrophils into anti-tumor (N1) neutrophils or pro-tumor (N2) neutrophils based on their activation status, cytokine production, and effects on tumor cells (Masucci et al., ; Fridlender et al., ). N1 neutrophils direct cytotoxic activity against tumor cells through production of hydrogen peroxide and nitric oxide, activate T cell-dependent adaptive immunity, and also limit bacterially driven inflammation (Dmitrieva-Posocco et al., ; Finisguerra et al., ; Fridlender et al., ). In contrast, N2 neutrophils can promote tumor cell proliferation by inhibiting T cell activation through release of reactive oxygen species and arginase 1 and also facilitate metastasis by assisting with formation of a pre-metastatic niche (Coffelt et al., ; Gabrilovich et al., ; Park et al., ). In the context of pancreatic cancer, neutrophil phenotypes are consistent with a pro-tumorigenic role. Human pancreatic cancer has abundant neutrophil infiltration (Chao et al., ; Reid et al., ), which is associated with poor prognosis (Wang et al., ). In addition, a high peripheral blood neutrophil-to-lymphocyte ratio is a negative predictor of overall survival and disease-free survival (Zhou et al., ). Neutrophil chemokines are correlated significantly with advanced clinical stage and shorter survival in human PDA (Li et al., ; Nywening et al., ). In our study, acquisition of neutrophils was associated with tumor growth and reduction of T cell accumulation, also suggestive of a pro-tumorigenic function. Two separate reports have explored the functional role of neutrophils in KPC mouse models of pancreatic cancer, primarily by modulating CXCR2 (Chao et al., ; Steele et al., ). Disrupting CXCR2 signaling prevented accumulation of neutrophils and induced T cell-dependent suppression of tumor growth in KPC tumors (Chao et al., ).
Because of the lack of response to single-agent immunotherapy in individuals with pancreatic cancer, combinatorial strategies are being actively explored in clinical trials (Siolas et al., ). Combination of the CD40 agonist antibody APXM and chemotherapy (with or without nivolumab PD1 therapy) showed an encouraging overall response rate of 54% in a phase Ib trial of individuals with metastatic pancreatic cancer and is currently under evaluation in an ongoing randomized phase II study (Vonderheide, ). Given that neutrophils suppress T cell proliferation and function, the ability to therapeutically target neutrophils is appealing and may open the door to improved efficacy of T cell-based therapeutics (Chao et al., ). There are two therapeutic agents targeting the CXCR2 chemokine axis currently in separate clinical trials, but neither has been explored with CD40 therapy (Bilusic et al., ; Evans, ). Our findings indicate that the gain-of-function mutant Trp53RH can cause accumulation of tumor-associated neutrophils, whose targeting may be used to augment the therapeutic efficacy of combination CD40 immunotherapy in pancreatic cancer. Furthermore, this contributes to the growing body of work showing that different tumor genotypes can have distinct immune profiles within pancreatic cancer, suggesting immunophenotype should be considered in therapy selection.
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Dafna Bar-Sagi (bilin.com.mxluyn@bilin.com.mx).
All unique/stable reagents generated in this study are available from the Lead Contact with a completed Materials Transfer Agreement.
This paper analyzes existing, publicly available data. These accession numbers for the datasets are listed in the key resources table.
KEY RESOURCES TABLE
| REAGENT or RESOURCE Antibodies | SOURCE | IDENTIFIER |
|---|---|---|
| APC/Cy7 anti-mouse CD3 (17A2) | BioLegend | Cat# ; RRID:AB_ |
| BV CD45 (F11) | BioLegend | Cat# ; RRID:AB_ |
| PE anti-mouse F4/80 (BM8) | BioLegend | Cat# ; RRID:AB_ |
| PE anti-mouse Foxp3 (FJK s) | Invitrogen | Cat# ; RRID:AB_ |
| APC/Cy7 anti-mouse CD11b (M1/70) | BioLegend | Cat# ; RRID:AB_ |
| PE anti-mouse CD80 (A1) | BioLegend | Cat# ; RRID:AB_ |
| PerCP/Cy anti-mouse CTLA4 (UCB9) | BioLegend | Cat# ; RRID:AB_ |
| APC/Cy7 anti-mouse MHCII I-A/I-E (M5/) | BioLegend | Cat# ; RRID:AB_ |
| PE anti-mouse Gr1 (RBC5) | BioLegend | Cat# ; RRID:AB_ |
| APC anti-mouse Ly6G (1A8) | BioLegend | Cat# ; RRID:AB_ |
| APC anti-mouse CD (CC2) | BioLegend | Cat# ; RRID:AB_ |
| Mouse BD Fc Block (G2) | BD pharmingen | Cat# ; RRID:AB_ |
| PE mouse anti-mouse T-Bet (4B10) | BD pharmingen | Cat# ; RRID:AB_ |
| APC anti-mouse CD4 (GK) | BioLegend | Cat# ; RRID:AB_ |
| PE/Cy7 CD8 () | BioLegend | Cat# ; RRID:AB_ |
| PerCP/Cy anti-mouse CD8 () | BioLegend | Cat# ; RRID:AB_ |
| PerCP/Cy anti-mouse CD86 (GL-1) | BioLegend | Cat# ; RRID:AB_ |
| PerCP/Cy Ep-CAM (G) | BioLegend | Cat# ; RRID:AB_ |
| PerCP/Cy anti-mouse PD1 (29F.1A12) | BioLegend | Cat# ; RRID:AB_ |
| Pe/Cy7 anti-mouse IFN-g (XMG) | BioLegend | Cat# ; RRID:AB_ |
| PE anti-mouse CD31 () | BioLegend | Cat# ; RRID:AB_ |
| Pe/Cy7 anti-mouse PDGFRa (APA5) | BioLegend | Cat# ; RRID:AB_ |
| PE anti-mouse CD11c (N) | BioLegend | Cat# ; RRID:AB_ |
| PE IgG1k isotype control | Invitrogen | Cat# ; RRID:AB_ |
| Pe/Cy7 Rat IgG1 isotype control | BioLegend | Cat# ; RRID:AB_ |
| InVivo rat IgG2a mAb (2A3) isotype control | BioXCell | Cat# BE; RRID:AB_ |
| InVivoMAb monoclonal anti-mouse Ly6G (1A8) | BioXCell | Cat# BE; RRID:AB_ |
| InVivoMAb CD40 rat anti-mouse IgG2a mAb (FGK45) | BioXCell | Cat# BE; RRID:AB_ |
| InVivoMAb anti-rat Kappa Immunoglobulin Light Chain | BioXCell | Cat# BE; RRID:AB_ |
| APC anti-mouse CD34 (HM34) | BioLegend | Cat #; RRID:AB_ |
| MPO antibody | Santa Cruz | Cat# sc; RRID:AB_ |
| Neutrophil Marker (NIMP-R14) antibody | Santa Cruz | Cat# sc; RRID:AB_ |
| P53 (1C12) Mouse antibody | Cell Signaling | Cat# S; RRID:AB_ |
| Anti-Vinculin mouse antibody | SigmaAldrich | Cat# V; RRID:AB_ |
| Bacterial and virus strains | ||
| STBL3 | ThermoFisher | Cat# C |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Nab-paclitaxel | Celgene | Cat# |
| Gemcitabine | Hospira | Cat# |
| Albumin | Sigma Aldrich | Cat# A |
| Xtremegene 9 | Roche | Cat# 06 |
| Polybrene | Sigma Aldrich | Cat# TRG |
| Hygromycin | Sigma Aldrich | Cat# |
| G | Sigma Aldrich | Cat# |
| PfIFI | New England Biolabs | Cat# RS |
| BsmBI | New England Biolabs | Cat#RS |
| Shield-1 | Cheminpharma | Cat# S |
| Lipofectamine | Life Technologies | Cat# L |
| Critical commercial assays | ||
| Surveyor DNA mutation Kit | IDT | Cat# |
| TOPO TA Cloning Kit | Thermo-Fisher | Cat# KJ10 |
| SYBR Green PCR Master Mix | Thermo-Fisher | Cat# |
| Quantitect Reverse Transcription Kit | QIAGEN | Cat# |
| Zombie Green Fixable Viability Kit | Biolegend | Cat# |
| RNeasy Mini Kit | QIAGEN | Cat# |
| Milliplex Mouse Cytokine Magnetic Bead Panel | Millipore Sigma | Cat# MCYTOMAGK |
| KAPA Mouse Genotyping Kit | Roche | Cat# |
| Foxp3/Transcription Factor Staining Buffer Set | Invitrogen | Cat# |
| Experimental models: Cell lines | ||
| HEKT | ATCC | Cat# ATCC® CRL |
| KrasG12D/+;Trp53+/+PDEC | Pylayeva-Gupta et al., | N/A |
| KrasG12D/+;Trp53/ PDEC | This manuscript | N/A |
| KrasG12D/+;Trp53RH/+PDEC | This manuscript | N/A |
| Experimental models: Organisms/strains | ||
| C57Bl6/J mice females (weeks) | Charles River Laboratories | CR: |
| Oligonucleotides | ||
| p53 sgRNA, CGG AGC AGC GCT CAT GGT GG | This manuscript | N/A |
| p53 HDR template, CAC CTC CAG CTG GGA GCC GTG TCC GCG CCA TGG CCA TCT ACA AGA AGT CAC AGC ACA TGA CGG AAG TCG TGA GAC ACT GTC CCC ACC ATG AGC GCT GCT CCG ATG GTG ATG GTA AGC CCT CAA CAC CGC CTG TGG GGT TAG GAC TGG CAG | This manuscript | N/A |
| p53 Forward PCR primer, TGGGA CAGCCAAGTCTGTTA | This manuscript | N/A |
| p53 Reverse PCR primer CCTGCT GTCTCCAGACTCCT | This manuscript | N/A |
| shScramble CCGGTCCTAAGGTTA AGTCGCCCTCGCTCGAGCGAGGG CGACTTAACCTTAGGTTTT | Sarbassov et al., | Addgene Cat # |
| CXCL2 forward PCR primer ATGC CTGAAGACCCTGCCAAG | Roy et al., | N/A |
| CXCL2 reverse PCR primer GGTC AGTTAGCCTTGCCTTTG | Roy et al., | N/A |
| CXCL5 forward PCR primer ACAGT GCCCTACGGTGGAAGT | Roy et al., | N/A |
| CXCL5 reverse PCR primer CGAGT GCATTCCGCTTAGCTT | Roy et al., | N/A |
| Recombinant DNA | ||
| pLKO.1 neo | Gift from Sheila Stewart | Addgene Cat# |
| psPAX2 | Gift from Didier Trono | Addgene Cat# |
| pMD2G | Gift from Didier Trono | Addgene Cat# |
| pLKO.1 hygro | Gift from Bob Weinberg | Addgene Cat# |
| LentiCRISPRv2 hygro | Stringer et al., | Addgene Cat# |
| conditional EDCPV | Gift from R. Sordella, Cold Spring Harbor Laboratory | N/A |
| Software and algorithms | ||
| ImageJ | Schneider et al., | bilin.com.mx; RRID:SCR_ |
| FlowJo version | FlowJo | bilin.com.mx; RRID:SCR_ |
| R version | RStudio | bilin.com.mx; RRID:SCR_ |
| Prism Version 7 | GraphPad | bilin.com.mx; RRID:SCR_ |
| Vevo Lab | FUJIFILM-VisualSonics | bilin.com.mx |
| Other | ||
| Whole-Tissue Gene Expression Data of Pancreatic Ductal Adenocarcinoma | Badea et al., | GSE |
| Expression data from Mayo Clinic Pancreatic Tumor and Normal samples | Pei et al., | GSE |
Open in a separate window
All data reported in this paper will be shared by the lead contact upon request.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
The LSL-KrasG12D/+;Trp53+/+;p48Cre/+ and LSL-KrasG12D/+;Trp53LSL-RH/+;p48Cre/+ mouse strains were previously described (Pylayeva-Gupta et al., ). The Institutional Animal Care and Use Committee at the New York University (NYU) School of Medicine approved all animal care and procedures. All mice were housed under conditions in line with NYU Institutional Animal Care and Use Committee guidelines. Mice were housed from 35 per cage and were kept in a h day/night cycle with light from until For orthotopic mouse models, 7to 9-week-old wild-type (WT) C57BL/6 (stock ) mice were purchased from The Charles River Laboratories. All mice were from a C57BL/6 genetic background. Female mice were used for orthotopic injections of CRISPR KrasG12D/+;Trp53RH/+ PDEC, KrasG12D/+;Trp53/ PDEC, and KrasG12D/+;Trp53+/+ PDEC cell lines using the method described in Das et al. (). For chemotherapy treatment, gemcitabine, pharmaceutical grade suspension at 38 mg/ml, was diluted to 12 mg/ml in PBS and administered at mg/kg via intraperitoneal (i.p.) injection (Byrne and Vonderheide, ). Nab-paclitaxel (Abraxane, Celgene) pharmaceutical grade powder was resuspended at 12 mg/ml in PBS and administered at mg/kg i.p., or an equivalent molar dose of human albumin (Sigma) was administered i.p. as control (Byrne and Vonderheide, ). Mice were injected on day 14 after orthotopic implantation. Chemotherapy was purchased through the NYU Langone Health pharmacy. Mice received ¼g of either agonist CD40 rat anti-mouse IgG2a mAb (clone FGK45, endotoxin-free) or the isotype control IgG2a mAb (clone 2A3) on day 16 after orthotopic surgery. Neutrophils were depleted by i.p. injection of ¼g Ly6G+ Ab (clone 1A8) and ¼g mouse IgG2a anti-rat antibody (clone Mar ) or isotype control mAb (clone 2A3) on day 12, repeated every 48 h. All antibodies were purchased from BioXCell. Mice were euthanized by carbon-dioxide-induced narcosis for flow cytometry analysis and tumor size assessment.
Isolation, culture, and adenoviral infection of pancreatic ductal epithelial cells (PDECs) was carried out as previously described (Pylayeva-Gupta et al., ). CRISPR-generated cell lines are described in the detailed Methods. HEKT cells were purchased from the ATCC and maintained in DMEM with 10% FBS and penicillin-streptomycin at 37°C. Scramble control shRNA (Sarbassov et al., ) and shRNAs against CXCL2 and CXCL5 were cloned into the lentiviral pLKO.1 neo (gift from Sheila Stewart) and pLKO.1 hygro (gift from Bob Weinberg) vectors, respectively, obtained from Addgene. Lentiviral particles were generated by transfecting HEKT cells using Xtremegene 9 with the pLKO.1 vector, the packaging construct (psPAX2, gift from Didier Trono), and the envelope plasmid (pMD2G, gift from Didier Trono). Supernatants containing viral particles were collected over a period of 48 h and stored at 4°C. Following final collection, supernatants were filtered through a ¼m-pore-size syringe filter and concentrated using MWCO Amicon Ultra centrifugal filters (Millipore). A multiplicity of infection (MOI) of 10 was used for lentiviral infection of PDEC cells in the presence of 10 ¼g/ml Polybrene (Chemicon), and infected cells were selected using ¼g/ml hygromycin (Sigma) or ¼g/ml G (Sigma). All data representative of 3 independent clones from 3 independent experiments
A sgRNA was designed to target the desired Trp53 mutation using CRISPR Design. The sgRNA sequence 5-CGG AGC GCT CAT GGT GG-3 was cloned into LentiCRISPRv2 (Stringer et al., ) from Addgene according to a published method (Sanjana et al., ) and infected into PDEC cells as described above. sgRNA efficiency was verified via a Surveyor nuclease assay as described (Senturk et al., ). sgRNA was also cloned into the conditional EDCPV vector (gift from R. Sordella) as detailed in Senturk et al. (). Virus packaging was achieved by transiently co-transfecting HEKT cells in cm culture dish with 3 ¼g of the p53sgRNAEDCPV, 6 ¼g of the packaging plasmid psPAX2, and 3 ¼g of the envelope plasmid pMD2.G (Addgene) using 30 ¼l of Lipofectamine reagent (Life Technologies). Viral particles of 10 ml were collected after 48 h of transfection by clarifying the supernatant through ¼m filter membrane (GE Healthcare). Virus transduction was optimized in order to achieve low-MOI transduction. A single-strand DNA homology-directed repair (HDR) template was created with sequence 5-CAC CTC CAG CTG GGA GCC GTG TCC GCG CCA TGG CCA TCT ACA AGA AGT CAC AGC ACA TGA CGG AAG TCG TGA GAC ACT GTC CCC ACC ATG AGC GCT CCG ATG GTG ATG GTA AGC CCT CAA CAC CGC CTG TGG GGT TAG GAC TGG CAG-3. A silent mutation (G A) was placed in the 5 protospacer adjacent motif (PAM) region and another silent mutation was designed for the 3 PAM region (C T) adjacent to the target to prevent multiple recombination events. This resulted in the creation of a unique restriction enzyme cloning site, PflFI (New England Biolabs), which would appear in target cells upon successful HDR, in conjunction with loss of the BsmBI restriction enzyme site (New England Biolabs). A cm dish of PDEC cells was transfected with single-strand DNA HDR template using 25 ¼L of Lipofectamine (Life Technologies). Shield-1, obtained from Cheminpharma, was solubilized in pure ethanol and added to the culture medium at a concentration of nM (final), and the cells were cultured for 24 h. After 24 h, Venus-positive single cells were sorted into five well plates using a BD FACS ARIA II sorter at the NYU Cytometry and Cell Sorting Facility and allowed to grow for 10 days. Genomic DNA was extracted and amplified as per manufacturers directions using KAPA Hot Start Genotyping kit (Sigma) and the primers 5-TGG GAC AGC CAA GTC TGT TA-3 and 5-TAA GGA TAG GTC GGC GGT TC-3. Restriction enzyme digestion was performed separately for BsmBI and PflFI to screen for successful HDR. Clones that were not digested by BsmBI, but were successfully digested by PflFI, were sent to Genewiz for Sanger sequencing. To determine heterozygosity, genomic DNA was amplified using the primers above and Phusion High-Fidelity DNA Polymerase (New England Biolabs). Amplicons were cloned using a TOPO TA Cloning Kit (Thermo Fisher) as per manufacturers instructions and transformed into STBL3 chemically competent cells. Twenty bacterial colonies containing plasmids were selected for DNA isolation and PCR. PCR products were used for direct Sanger sequencing (Genewiz). In addition, all CRISPR KrasG12D/+;Trp53RH/+ and KrasG12D/+;Trp53+/+ PDEC cell lines used in this paper were analyzed by RNA sequencing. RNA was isolated using an RNeasy kit (QIAGEN) and genomic DNA was removed using an RNase-free DNase kit (QIAGEN). RNA sequencing was performed by NYU Langones Genome Technology Center using an Illumina HiSeq instrument. Three cell lines were created for each genotype. KrasG12D/+;Trp53+/+ cell lines were infected and single cell sorted as above, but were not treated with Shield-1 and therefore did not undergo DNA editing. KrasG12D/+;Trp53/ PDEC cell lines were generated by treating with Shield-1 as above, but without the addition of a HDR template.
Single-cell suspensions were prepared from pancreata as described (Pylayeva-Gupta et al., ), and tumor-infiltrating lymphocytes were isolated as described (Das et al., ). All samples were acquired on an LSR II instrument (BD Bioscience) at the NYU Cytometry and Cell Sorting Facility and analyzed with FlowJo version (TreeStar, Inc.). Cell sorting using a BD FACS ARIA II sorter was performed to isolate Ep-CAM+ cells and CD45+ cells, and 95% purity of sorted cells was achieved. All data representative of 3 independent clones from 3 independent experiments
Mouse pancreata were fixed overnight in 10% buffered formalin (Fisher Scientific) and embedded in paraffin as described earlier (Pylayeva-Gupta et al., ). For histology analysis, excised tumors were processed for routine hematoxylin and eosin staining. For immunehistochemistry, methods were as in (Das et al., ), with rat anti-Ly6G (, Santa Cruz) used as the primary antibody. Slides were examined on a Nikon Eclipse 80i microscope. Immunofluorescence staining using Ki or MPO, along with CK19, was performed at the NYU Experimental Pathology Research Laboratory. Scoring of tumor sections for individual markers was performed by counting 10 fields using Omero imaging software and images were analyzed to measure stained area using ImageJ software (Schneider et al., ).
For assessment of cell cycle genes, cultured PDEC cells were treated with ¼M of doxorubicin for 36 hr and then subjected to RNA extraction with a RNeasy Kit (QIAGEN) as per the manufacturers instructions. Total RNA (1 ¼g) was reverse-transcribed using the Quantitect Reverse Transcription Kit (QIAGEN). Subsequently, specific transcripts were amplified with SYBR Green PCR Master Mix (USB) using a Stratagene Mx P thermocycler. Primer sequences for Cxcl2 and Cxcl5 are in key resources table (Roy et al., ). Where fold expression is specified, the comparative CT method was used to quantify gene expression. Expression was normalized to that of GAPDH. For RNA isolation from tumors, pancreata processed to single-cell suspension were stained for flow cytometry. CD45CD34PDGFRaEp-CAM+ cells or CD45+ immune cells were FACS sorted using a ¼m nozzle into the lysing reagent RLT, and total RNA was extracted as per the manufacturers instructions (RNeasy Mini Kit, QIAGEN). To check knockdown in PDEC cells, 105 cells were lysed in ¼L RLT reagent and total RNA was extracted as per the manufacturers instructions (RNeasy Mini Kit, QIAGEN). QPCR was performed as described above.
human PDAC tumor (n = 75) and Adj Norm (n = 55) mRNA expression profiles generated on the same array (Affymetrix GeneChip Human Genome U Plus ) were downloaded from GEO (GEO: GSE (Badea et al., ), GSE (Pei et al., )) and processed as previously described (Gadaleta et al., ). CXCL cytokines plots and an unpaired Students t test were generated in GraphPad Prism (GraphPad Software, CA, USA; bilin.com.mx). TCGA data (Pancreatic Adenocarcinoma, TCGA Firehose Legacy) were analyzed in cBioPortal (bilin.com.mx). PDAC tumors with very low tumor cell content ( 33%) or labeled as non-PDAC, were removed and n = 58 tumors with hotspot missense mutations in TP53 DNA binding domain and n = 63 tumors without mutations or homozygous deletions were compared using cBioPortals Groups analysis function. Genes with significantly higher expression (q value ) in p53 mutated versus WT tumors were imported into Enrichr (bilin.com.mx), and assessed for enrichment in Gene Ontology Biological Process gene sets.
Image acquisition and analysis were performed at the NYU Preclinical Imaging Laboratory. Mice were anesthetized with 2% isoflurane and placed on a physiological stage interfaced to a Vevo (Visualsonics, Fujifilm) high frequency ultrasound scanner. The stage monitored the mouses core temperature, respiration rate and heart rate. The abdominal area was wet shaved, ultrasound gel applied and an MXDD transducer lowered until a transverse section of the tumor was centered in the field of view. The transducer was connected to a stepper motor and a 3D volume was acquired using a micron slice spacing. The volumetric data was then imported to the Vevo LAB (Visualsonics, Fujifilm) analysis software. The tumor was segmented by drawing contours around the periphery of the tumor for each slice and the volume calculated by the volume measurement tool.
Cultured PDEC cells were treated with ¼M of doxorubicin for 24 hr. Cells were lysed in sample buffer, denatured at 95°C, and resolved on polyacrylamide gels. Cells were probed for p53 with monoclonal anti-mouse p53 antibody. Vinculin was detected as a loading control. Secondary antibodies were purchased from LiCOR IRDye CW and CW.
Orthotopic tumors were minced with a razor blade and incubated in RPMI media for one hour at 37°C. The solution was centrifuged for 2 min at RPM in a microcentrifuge. The supernatant was then assayed according to the manufacturers instructions using a MILLIPLEX Mouse Cytokine/Chemokine Magnetic Bead Panel, in a Luminex (Luminex Corporation, Austin, TX, USA) machine.
At least 5 mice were included in each group, unless noted and the experiments were repeated a minimum 2 times. Group means were compared with Student t tests. Significance of variations between two groups was determined by an unpaired Student t test (two-tailed). Statistical analyses were performed using GraphPad Prism software (version d), and data are presented as mean ± SD p was considered statistically significant. Statistical details and p values of experiments can be found in the corresponding figure legends.
Gain-of-function Trp53RH promotes neutrophil recruitment to pancreatic tumors
Neutrophils in KrasG12D/+;Trp53RH/+ tumors are due to tumor-cell-derived chemokines
Neutrophils confer resistance to CD40 combination immunotherapy and chemotherapy
We thank L.J. Taylor for help with manuscript preparation. We thank the NYU Cytometry and Cell Sorting Laboratory Facility, Preclinical Imaging Laboratory, and Experimental Pathology Research Laboratory, which are partially supported by Perlmutter Cancer Center grant P30CA and NIBIB grant NIH P41 EB This work was funded by NIH/NCI CA (to D.B.S.) and by the Lustgarten Foundation Pancreatic Cancer Dream Team (SU2C-AACR-DT to D.B.-S.). D.S. is supported by NIH K08CA E.A.V. was supported by a Canadian Institutes of Health research fellowship (). E.K. was supported by NIH F30 CA The graphical abstract was created with BioRender.
Flowjo cracked
FLOWJO CRACKED CRACKED
FLOWJO CRACKED SERIAL NUMBER
In addition, the user interface of the program is designed very simply and ribbons are used to group the tools, which gives quick access to the desired tool. In this program, you are able to define different samples in separate groups and analyze them in order. By right-clicking on different samples, you can change the group profile, including name, color, font, styles, roles, and so on. For each example separately, you can perform various operations such as adding keywords, statistics, displaying datasets, and so on. This program can be used for both research and clinical purposes and has provided useful tools and capabilities in every field. Therefore, analyzing this data in the computer automatically and by drawing three-dimensional diagrams has made the work of researchers very easy. Also, the cell sort is a big thing for you where you can check plugins for that. it will trailblaze the discoveries, simply by curiosity style of data representation. This technique has many applications in the study of health disorders, especially cancer. For this purpose, the FlowJo Crack is now introducing you as an online source for the creation of turn burning. Measuring scales are usually logarithmic with high accuracy. This program is able to display the collected data in the form of one-dimensional, two-dimensional, or three-dimensional histograms. FlowJo is one of the powerful software in the field of analysis and display of flow cytometric data. For your delivery in new ways, you can also observe more things. FlowJo Crack have a user friendly interface and exist on main workspace and many ribbons that contain tabbed bands which allow you to scroll through many bands to access different tasks. Flowjo Crack can guide you a lot for flow cytometry.
FLOWJO CRACKED SERIAL NUMBER
After the data was collected by this device, by entering it into the computer and analyzer software, we no longer have anything to do with the device and we can continue to work with the software. FlowJo Crack With Serial Number The FlowJo Crack is a powerful application that facilitate you an environment for displaying and analyzing flow of data. Flucymetry, or FCM, is a good way to count and analyze microscopic particles such as. Description: FlowJo is a powerful software for displaying and analyzing fluorescent data.
FLOWJO CRACKED CRACKED
This is done by a special device called a flow cytometer.Ī flow cytometer is able to derive the phenotype and characteristics of cells based on fluorescence emission. Download FlowJo x86 圆4 full license working forever Link download FlowJo win32 win64 full cracked forever. Flow cytometry or FCM is a suitable method for counting and analyzing microscopic particles such as chromosomes and cells. FlowJo is a powerful software for displaying and analyzing flow cytometric data.
#Flowjo cracked
0 notes
Flowjo cracked
#Flowjo cracked how to#
#Flowjo cracked for mac#
Paste number FlowJo vX download crack Pasted by: sxv sx When: 5 years, 11 months ago Share:
0 Comments