Results
Establishment and application of Li deposition model
As shown in Fig. 1a, the major SEI components can be classified into two groups with high and low Li+ mobility, according to their distinct energy barriers for Li+ diffusion. Hence, the Li deposition process is influenced by the local energy barrier of SEI, accompanied by the inhomogeneous distribution of electrolyte concentration. Although SEI has a complex composition and distribution of components, it can be simply distinguished into high and low mobility zones by equivalence approximation (Fig. 1b). To quantitatively assess how the SEI affects Li deposition, we establish a model based on the law of Li mass conservation (Fig. 1c). Figure 1d displays an equivalent circuit (Detailed discussion in Supplementary Note 1) to elucidate the effects of various parameters on Li+ diffusion across electrolyte and SEI. The total Li+ capacity Qtotal of an LMA can be divided into irreversible loss Qir due to dead Li and SEI formation, residual Li QLi-residue (Supplementary Note 2) due to uneven deposition and desired Li deposition Qdeposit, i.e.
$${Q}_{{{{\rm{total}}}}}={Q}_{{{{\rm{deposit}}}}}+{Q}_{{{{\rm{ir}}}}}+{Q}_{{{{\rm{Li}}}}-{{{\rm{residue}}}}}$$
(1)
a Diffusion energy of Li+ diffusion for various SEI components34,66,67,68,69. b Schematic illustration of Li deposition process and model parameters. c Capacity conservation during a complete Li deposition process. d Equivalent circuit for Li+ diffusion across the electrolyte and SEI (RSA and RSC represent the anode and cathode interface resistance, respectively). e Dependence of Li plating on the Li+ mobility of SEI.
Full size image
An evaluation parameter Qloss can be readily defined as
$${Q}_{{{{\mathrm{loss}}}}}={Q}_{ir}+{Q}_{{{{\mathrm{Li-residue}}}}}={Q}_{ir}+\frac{{t}_{{{{\rm{dis}}}}}({j}_{{{{\rm{h}}}}}-{j}_{{{{\rm{l}}}}})A\theta }{nF}$$
(2)
where jh and jl represent the current density corresponding to high and low mobility pathways, respectively, tdis is total deposition time, A is the area of Li foil, θ means the proportion of low mobility region, n is the stoichiometric number of electrons consumed in the electrode reaction (e.g., 1 for reduction of Li+) and F is the Faraday’s constant (96485 C mol−1).
Then, Eq. (2) can be rearranged after substituting Eq. (10) in supporting information
$${Q}_{{{{\mathrm{loss}}}}}={Q}_{ir}+\frac{A{t}_{{{{\rm{dis}}}}} \, j}{nF}\frac{1-\frac{{D}_{{{{\rm{S}}}},{{{\rm{l}}}}}}{{D}_{{{{\rm{S}}}},{{{\rm{h}}}}}}}{\frac{(1-\theta )}{\theta }+\frac{{D}_{{{{\rm{S}}}},{{{\rm{l}}}}}}{{D}_{{{{\rm{S}}}},{{{\rm{h}}}}}}+\frac{L{D}_{{{{\rm{S}}}},{{{\rm{l}}}}}}{2\theta \delta {D}_{{{{\rm{E}}}}}}}={Q}_{ir}+k\cdot j$$
(3)
where a slope k is introduced for simplifying the linear expression, L is the internal electrode distance, δ is the thickness of SEI, DE represents the Li+ diffusion in a bulk electrolyte, Ds,l and Ds,h represents low and high Li+ diffusion through SEI, respectively.
It is worth noting that tdis is determined by the total capacity and applied current density together and will be a specific constant value under a certain condition. As for the slope k, it is a significant parameter over the range from 0 to 1 that reflects the homogeneity of Li+ flux across SEI. The detailed k value can be influenced by several factors but mainly by the Li+ mobility of SEI components: (i) Initial roughness of Li foil and separators can disturb Li+ diffusion pathways; (ii) Viscosity and conductivity of electrolytes can affect Li+ diffusion velocity; (iii) Difference between Ds,l and Ds,h takes the major responsibility for uneven Li+ distribution before Li deposition. A homogenous diffusion across SEI will be realized when 'Ds,l → Ds,h; or 'θ → 0' (Fig. 1e), which also means 'k → 0'. The larger the k deviates from 0, the more heterogeneous the Li+ flux is. Moreover, a larger proportion of low mobility SEI, i.e., higher θ, leads to larger k as well as more Li-residual capacity loss. The low utilization of Li foil will undermine LMBs because a thin Li foil or zero excess Li is always required to maximize the energy density. Additionally, the intercept Qir indicates the irreversible capacity due to the formation of SEI or dead Li. Thus, the maximum CE of LMA in a selected electrolyte can be determined by:
$$C{E}_{\max }=\frac{{Q}_{{{{\rm{total}}}}}-{Q}_{{{{\rm{ir}}}}}}{{Q}_{{{{\rm{total}}}}}}$$
(4)
Therefore, Eqs. (3 and 4) offer a methodology to evaluate the electrochemical performance of LMA in a designed electrolyte. Different from Sand’s time which focuses only on the bulk electrolyte, our proposed model integrates the SEI properties with bulk electrolyte to manifest critical parameters for Li growth.
To validate the proposed theory, the most efficient electrolytes (Table S1) reported recently were employed for the investigation based on Eq. (3) (Details in Fig. S3). The relationships of Qloss vs. j for different electrolytes are displayed in Fig. 2a. All the fitted plots present an obvious linear correlation, demonstrating the feasibility of this mathematical model in evaluating different electrolytes. Moreover, the potential CEmax of LMA in various electrolytes is evaluated by Eq. (4). The obtained k, Qir, and CEmax are presented in Fig. 2b. HCE, dimethyl carbonate-1,1,2,2-tetrafluoroethyl-2,2,3,3-tetrafluoropropyl ether (DMC-TTE), dimethoxyethane-fluorobenzene (DME-FB) and DME-TTE show high k values (15.410, 9.289, 7.072, 3.007). Although these advanced electrolytes have shown high CE26,30,31,44, the LiF-rich SEI with a high energy barrier still leads to inhomogeneous Li+ distribution at high Li plating capacity. It should be noted that the decreasing order of k values follows the increasing order of Li+ conductivity of the electrolytes (Fig. S4a). This agrees well with the empirical rule that electrolytes with higher bulk ionic conductivity often generate SEI with lower impedance5,45. Moreover, the high viscosity of HCE (Fig. S4b) further increases the k value (15.410). BE exhibits a low k (1.742) due to its high Li+ conductivity, but the high Qir (3.825 mAh cm−2) suggests a low CE for LMA. The delicate SEI and dead Li formed in BE exclude its application in LMBs46. Therefore, enhancing the Li+ conductivity of LiF-rich SEI without compromising the mechanical strength is promising to stabilize LMA. To this end, a dual-halide electrolyte (1.3 M LiFSI in DME/1,2-dichloroethane (DCE) shown in Table S2 and Fig. S4c, termed as 1.3 M LDC) is specially designed to produce dual-halide (LiF1-xClx) SEI (Fig. S5), where Cl doping can endow the LiF1-xClx phase with fast Li+ conductivity and sufficient mechanical stability due to the lower ionic migration energy barrier (LiCl vs. LiF, 0.09 eV vs. 0.17 eV)47,48 and high surface energy (37.55 meV Å−2)8 of LiCl (This will be discussed in detail later). As shown in Fig. 2a, b, 1.3 M LDC shows the lowest k value (0.533) among all the electrolytes, manifesting that the dual-halide SEI can support uniform Li+ diffusion and maintain stable Li growth at various current densities. Furthermore, the lowest Qir (0.232 mAh cm−2) and highest CEmax (99.75%) indicate the impressive electrode/electrolyte interface chemistry in LDC electrolyte.
a Fitted plots of Qloss vs. j based on Eq. (3). b Comparison of k values, CEmax, and Qir for different electrolytes. c Optical images of Li deposits and cathode shells in BE, HCE, and 1.3 M LDC, respectively. d Schematic illustration of Li deposition in the case of k > 0 and k → 0. The simulation results of Li+ concentration and potential distribution across the LiF-rich SEI (e, f) and dual LiF1-xClx-rich SEI (g, h). All error bars are evaluated by standard deviation.
Full size image
To highlight the reliability of dual-halide electrolytes on stable Li plating, the optical images of Li deposits are displayed in Fig. 2c, which reconfirm the schematic models in Fig. 1e. Both BE and HCE electrolytes lead to rough Li deposits and obvious Li residues. Flat Li deposits and clean shells are observed in 1.3 M LDC electrolyte, which remains consistent even at high current densities (Fig. S6). Therefore, the fluctuation of local current density rather than high average current density induces Li dendrites43. According to the proposed protocol, LiF-rich SEI with k > 0 suffers from inhomogeneous Li+ diffusion, promoting the appearance of Li dendrites (Fig. 2d). The LiF1-xClx-rich SEI lowers the k → 0 because of the low and homogeneous energy barrier for Li+ diffusion. To clarify this principle, the Li+ flux and potential drop across electrolyte and SEI are visualized, respectively. The high Li+ diffusion energy barrier of LiF-rich SEI is primarily responsible for the uneven Li+ concentration across electrolytes (Fig. S7) and SEI (Fig. 2e, f) before Li deposition. However, the high Li+ mobility of LiF1-xClx-rich SEI enables uniform Li flux and potential distribution through both electrolytes (Fig. S8) and SEI (Fig. 2g, h), realizing high-efficiency Li plating/stripping.
Interface chemistry of LMA in dual-halide electrolyte
To elucidate the interfacial chemistry of LMA in the dual-halide electrolyte, Li+ solvation structure and surface components are investigated to clarify the formation of dual-halide SEI on LMA. Figure 3a displays the Raman spectra of different electrolytes. Free DME molecules are characterized by peaks at 820 and 847 cm−144. As the Li+ concentration increases, the free DME molecules are coordinated by the Li+ ions, with the peak shifting to 872 cm−1 in HCE. Meanwhile, the free FSI− anions at 717 cm−1 blueshifts to 752 cm−1, which indicates that the FSI− anions are also involved in the Li+ solvation structure in the form of contact ion pairs (CIPs) or aggregate (AGG)49,50. With the addition of DCE, the solvation structures remain unchanged. To further specify the Li+ solvation structure, molecular dynamics (MD) simulation of 1.3 M LDC electrolyte was conducted (Fig. 3b). The solvation shell of Li+ ions was statistically analyzed, as displayed in Fig. 3c. In the Li+ solvation shell, the ratio of FSI−, DME and DCE is 2.67:1.02:0.02 on average. In detail, FSI−/DME with the statistical ratio of 3/1 and 2/1 accounts for 45 and 29%, respectively. The representative solvation structures are illustrated in Fig. 3d. When the statistics are centered on the FSI− anions, the number of adjacent Li+ ions above 2 accounts for 90% (Fig. 3e). Furthermore, the radial Li-Li pair distribution function was calculated and analyzed in Fig. S9, where ion clusters with a size of 6 Å account for the largest proportion. These results demonstrate the AGG solvation structure dominates in 1.3 M LDC electrolyte. The radial distribution functions and corresponding coordination number of Li-ODME, Li-OFSI, and Li-ClDCE pairs were calculated from the final 1 ns trajectory, as shown in Fig. 3f. The sharp peaks at 2 Å suggest the close contact of Li+/DME and Li+/FSI− pairs, while the weak hump at 6.5 Å of Li-ClDCE pair indicates the feeble interactions between Li+ ions and DCE molecules. The weak solvation of DCE molecules to Li+ ions is also observed in the snapshots of simulated 1.3 M LDC electrolyte (Fig. 3b). These phenomena indicate the preferential decomposition of FSI− anions in 1.3 M LDC electrolyte, accompanied by the DCE decomposition (Fig. S5) to produce LiF1-xClx species, which is demonstrated by the ab initio MD in Fig. S10.
a Raman spectra of the solvents and electrolytes. b Simulated structures of 1.3 M LDC electrolyte. c Proportion of FSI−/DME with different ratios in 1.3 M LDC electrolyte. d Typical Li+ solvation structures with FSI−/DME ratio of 3/1 and 2/1. e Number of adjacent Li+ ions centered on the FSI− anions. f Radial distribution functions of Li-ODME, Li-OFSI-, and Li-ClDCE pairs in 1.3 M LDC electrolyte. XPS depth profiles of g F 1 s spectra, h Cl 2p spectra, i C 1 s spectra, and j Li 1 s spectra. The LMA is obtained from a Li
f.lux changes the color temperature of your computer’s display depending on the time of day. Everything’s normal during the day, but f.lux users warmer colors after sunset to match your indoor lighting.
This free tool is available for Windows, Mac, and Linux, and it’s most often used on laptops and desktops. However, f.lux can also be used on iPhones and iPads if you jailbreak, and there are similar utilities available for Android.
The Theory Behind f.lux
RELATED:Reduce Eye Strain When Using Smartphones and Tablets in the Dark
The lighting of the world around us changes depending on the time of day. During the day, we’re exposed to bright sunlight that has a cool, blue color temperature. This helps keeps us awake and affects our circadian rhythms. At night, the bright sunlight is gone — instead, we’re using indoor lighting that is generally dimmer and warmer. Our brains secrete melatonin during these darker hours when we’re not exposed to sunlight, causing us to get sleepier.
But our computers didn’t get the message. The theory is that staring at these bright, sun-like screens — late into the night or morning, as many of us do — strains our eyes and inhibits melatonin production. Yes, some computers have brightness sensors and will adjust the screen brightness depending on how bright it is around you, but the color temperature doesn’t change.
f.lux will use warmer colors at night than during the day, making white colors appear a bit more reddish. The theory is that looking at a warmer display at night will help reduce eye strain, and — because you’re not staring at a bright, sunlight-like screen — cause your brain to secrete more melatonin and help you get to sleep earlier and sleep better.
Just look at the blue glow you see coming from a screen at night, and then compare it to the warmer, redder glow coming from a typical light bulb. f.lux aims to make that blue glow more of a reddish glow. Here’s a good illustration of the Kelvin color temperature scale, which is used to quantify color temperature.
Does It Actually Work?
We just covered the promise of f.lux, anyway. Some people just use f.lux because it makes their screens easier on the eyes, some use it because they think it helps them sleep better, and some use it for both reasons. But, obviously, we can’t just trust these claims without looking at the science behind them.
Unfortunately, there have been no scientific studies of f.lux itself. However, a variety of studies have found that being exposed to bright blue light can affect your sleep schedule. Subjectively, many of us have realized that staying on the computer staring at a bright screen late at night keeps us awake, while stepping away from that screen helps make us more tired.
f.lux’s website has information about research in the area. While we can’t say f.lux’s claims have been scientifically proven, we can certainly say they seem plausible.
How to Get Started With f.lux
f.lux is free to download and use, so you can try it out for yourself if you’re curious.
- Windows, Mac, and Linux: Grab f.lux from the official website and install it.
- iPhone and iPad: You’ll have to jailbreak your iOS device and get this software from Cydia if you desperately want it. Apple’s restrictions prevent software from doing this. However, Apple has its own very f.lux-like feature built into iOS 9.3 called Night Shift that you can use instead.
- Android: You can get f.lux for Android, but it’s only available on rooted phones. Similar apps like Twilight are available for non-rooted devices.
f.lux isn’t the kind of program you constantly fiddle with. Instead, you’ll want to set it up once and then mostly forget about it.
It will try to automatically detect your location, but it doesn’t work all that well. You’ll want to go into the Settings screen to enter a more precise location. You can also adjust the desired light temperatures and choose a slow transition speed, so the colors on your screen will gradually change over 60 minutes instead of 20 seconds. Remember, you won’t see any change until after sunset — or up to an hour before sunset, if you choose the Slow transition speed.
f.lux also has various extra features. For example, it can automatically adjust the colors of Phillips Hue lights in your house, as well. The Mac version can even automatically enable OS X Yosemite’s dark theme at night.
When You Might Not Want to Use f.lux
RELATED:Improve Digital Photography by Calibrating Your Monitor
f.lux may not be something you’ll want to use all the time. If you’re a graphic designer who depends on accurate color reproduction for the work you do in Photoshop or another image-editing program, it will cause problems. When watching a movie or playing a game on your computer, you may prefer accurate reproduction of colors over the warmer colors f.lux provides.
To help with this, f.lux provides an easy option that allows you to quickly disable it for an hour or for an entire night. There’s also a “Movie Mode” option that lasts two and a half hours after you enable it. As the official FAQ puts it: “We designed Movie Mode to preserve sky colors and shadow detail, while still providing a warmer color tone. It’s not perfect on either count, but it strikes a balance.”
f.lux doesn’t make any permanent changes — after you disable it, it will go back to the same color calibration your monitor was set to use.
f.lux may seem very pink at first, so be sure to stick with it for a while if you decide to give it a try. As the official FAQ puts it: “On first use, it can take a while to adjust to the halogen settings. Try adjusting the color temperature sliders under Settings until you find one you like. Start with fluorescent or halogen and change it when your eyes adjust.”
This certainly matched my experience — at first, f.lux looked very pink. After fifteen minutes, it started to look normal. And, after disabling f.lux, everything looked very blue.
Image Credit: Asher Isbrucker on Flickr, Michelle D on Flickr
Tackling realistic Li+ flux for high-energy lithium metal batteries
Introduction
The revived Li metal batteries (LMBs) pave the way to the target energy density of >350 Wh kg−1 thanks to Li metal anode (LMA) with the highest theoretical specific capacity (3860 mAh g−1) and the lowest redox potential (−3.04 V vs. the standard hydrogen electrode) among all possible anodes1,2,3. However, dendritic Li and low Coulombic efficiency (CE) deteriorate LMBs. This is mainly attributed to the absence of a stable and uniform solid electrolyte interface (SEI) dictated by the interfacial reactions between the LMA and electrolytes4,5,6. An ideal SEI should hold the merits of fast Li+ but negligible electron conduction, high mechanical strength, and high interfacial energy to LMA7. Therefore, electrolyte engineering is decisive in inhibiting Li dendrites and realizing high CE by tuning the SEI components.
LiF has been regarded as one of most effective SEI components due to its low electronic conductivity and high surface energy (73.28 meV Å−2)8, which can prevent the formation of Li/SEI interface (i.e., Li dendrites). Moreover, the small lattice constant of LiF allows the SEI to deform elastically with a constantly changing morphology of LMA9. Hence, constructing LiF-rich SEI shows effectiveness in suppressing Li dendrites and preventing side reactions between LMA and electrolytes10,11,12,13,14,15. Inspired by this concept, a myriad of efforts have been devoted to modulating fluorinated electrolytes, including fluorinated solvents16,17,18,19,20,21, electrolyte additives22,23,24,25, high-concentration electrolytes (HCE)9,26,27,28 and localized HCE29,30,31,32,33, etc. These electrolytes succeeded in building LiF-rich SEI due to their high-fluorine content, which enables reversible LMBs featuring impressive CE values of >99%. However, LiF suffers from poor Li+ conductivity (~ 10−31 S cm−1)34, i.e., a high Li+ diffusion energy barrier, which can cause inhomogeneous Li+ flux across SEI. The uneven Li+ distribution at the substrate surface could induce undesired dendritic deposition as the cycle proceeds35. This kinetic mechanism of Li dendrite formation in LMBs remains unsolved despite the aforementioned advantages of LiF-rich SEI. Thus, revealing how the SEI kinetically affects Li deposition is highly demanded for designing advanced electrolytes.
As an early model referring to transition metal deposition in aqueous solutions, Sand’s time (tSand) recurs to describe the onset of dendritic Li growth36,37. The tSand features a zero Li+ concentration at the substrate surface. The cation-deficient zones promote Li growth at surface protrusions, which quickly develop into sharp dendrites due to the continuously preferential deposition. Multiple studies have proposed some underlying Li growth modes inspired by tSand, which suggested significant strategies for more durable LMBs38,39,40,41. It should be noted that tSand focuses on the Li+ transfer through bulk electrolyte while omits the subsequent Li+ migration inside SEI, which has been considered the rate-limiting step for Li deposition42. Additionally, the use of tSand requires that the actual current density reaches or exceeds the limited value. This is inaccessible in practical LMBs because the short inter-electrode distance defines a high threshold of 250 mA cm−243. Therefore, the modeling of Li growth in actual cases is still poorly developed.
In this work, to address the above challenges, we establish a mechanistic protocol that deciphers the dependence of Li deposition on SEI, validated by an explicit assessment reflecting the compatibility of the most successful fluorine-rich electrolytes to LMA. The jagged Li deposition originates from the non-uniform Li+ mobility of SEI components. A promising strategy to accommodate uniform Li+ distribution over the substrate is enhancing Li+ conductivity of LiF regions in SEI. Such implications of the proposed protocol inspire the design of a dual-halide (F and Cl) electrolyte, which in situ produces a dual-halide (LiF1-xClx) SEI on LMA. Compared to the LiF phase, Cl doping enables the LiF1-xClx phase to have a fast Li+ conductivity together with a six-fold lower energy barrier without compromising mechanical stability. The effectiveness is evidenced by an improved CE (>99.5%) in Li Li cell with BE and HCE suffers from growing overpotential and short circuit within limited cycles (<1000 h). The high reversibility and stability of LMA in 1.3 M LDC confirm the robustness of LiF1-xClx-rich SEI. To further evaluate the stability of dual-halide SEI, electrochemical impedance spectroscopy (EIS) of Li
Commit error: F.lux Features Crack Key For U
| GLARY UTILITIES PRO KEY 2018 FREE ACTIVATORS |
| IOBIT SMART DEFRAG KEY CRACK KEY FOR U |
| DRIVER EASY PRO CRACK ONHAX CRACK KEY FOR U |
| EasyBCD 2.4.0 Free Download with Crack |
| F.lux Features Crack Key For U |
F.Lux Crack & License Key 100% Working
By Shoaib September 14, 2020PC Softwares
F.Lux Crack
How many times does your Windows screen goes blank, when you are simply copying something from the PC and not using the mouse or the keyboard? Many times! The screen goes blank so many times, and the brightness keeps hurting your eyes as well.
Why not get a software, which can solve this problem and you can study or use your PC as much as you want? F.Lux is one such software, which can take into account the fact that the sun has set where you live, and make your computer resemble indoor lights.
For example, when you open the user interface of F.Lux, you can adjust your lighting for day and night. The software even f.lux Features Crack Key For U you the option to disable for one hour (for doing color-sensitive work). You can set your location, and transition speed; fast is 20 seconds, and slow is 60 minutes, f.lux Features Crack Key For U. The software will know how many hours the sunset is.
F.Lux Crack & License Key 100% Working
If you want to download F.Lux Crack from a website, then visit this one, and you can easily download, install and use it.
Download Crack With Free Key
This software does what it promises the user will do. This is an open-source Linux product, and you can use it on Mac and Windows both. The setup process and installation is minimal, and the software will start working in a few minutes.
When you benefit from the lighting settings that F.Lux offers, then you will feel less strain on your eyes. This is a highly recommended software, because it has a small footprint, as it doesn’t take up much space.
It is also a free program, and if you want, it can cut out the blue light as well. The user interface is easy to use, and the last time it was updated was on 08/29/2019. If you visit the website given in this article, then you can know more after watching the video preview, of how to download this software on your PC.
Features of F.Lux Crack 100% Working
If you are working on your PC during the morning, the screen will feel like sunlight. F.Lux is ever ready to hear you, f.lux Features Crack Key For U, and the kind of lighting that you need, especially where you live. If you spend most of your day on your computer, then it is very important that the monitor looks comfortable to you. F.Lux can automatically increase and decrease the brightness of your screen, and all you have to do is make some adjustments in the main software.
Tags:F.Lux Crack, F.Lux Crack f.lux Features Crack Key For U License Key, F.Lux License Key
About Author
Shoaib
I am the one who loves to read and also has a special interest in writing. I have written for many websites and shared my views with the reader. I have always received warmth and love from my audience. I hope you will love my work too.
ABA-dependent K+ flux is one of the important features of the drought response that distinguishes Catalpa from two different habitats
Wenjun Ma,a,b,c,dGuijuan Yang,a,b,c,dYao Xiao,a,b,c,dXiyang Zhao,e and Junhui Wanga,b,c,d
Wenjun Ma
aState Key Laboratory of Tree Genetics and Breeding, Beijing, PR China
bResearch Institute of Forestry, Chinese Academy of Forestry, Beijing, PR China
cKey Laboratory of Tree Breeding and Cultivation, State Forestry and Grassland Administration, Beijing, PR China
dNational Innovation Alliance of Catalapa Bungei, Beijing, PR China
Find articles by Wenjun Ma
Guijuan Yang
aState Key Laboratory of Tree Genetics and Breeding, Beijing, PR China
bResearch Institute Home Plan Pro Crack 5.8.2.1 with Serial Number [Latest] 2021 Free Forestry, Chinese Academy of Forestry, Beijing, PR China
cKey Laboratory of F.lux Features Crack Key For U Breeding and Cultivation, State Forestry f.lux Features Crack Key For U Grassland Administration, Beijing, PR China
dNational Innovation Alliance of Catalapa Bungei, Beijing, PR China
Find articles by Guijuan Yang
Yao Xiao
aState Key Laboratory of Tree Genetics and Breeding, Beijing, PR China
bResearch Institute of Forestry, Chinese Academy of Forestry, Beijing, PR China
cKey Laboratory of Tree Breeding and Cultivation, State Forestry and Grassland Administration, Beijing, PR China
dNational Innovation Alliance of Catalapa Bungei, f.lux Features Crack Key For U, Beijing, PR China
Find articles by Yao Xiao
Xiyang Zhao
eNortheast Forestry University, Harbin, PR China
Find articles by Xiyang Zhao
Junhui Wang
aState Key Laboratory of Tree Genetics and Breeding, Beijing, PR China
bResearch Institute of Forestry, Chinese Academy of Forestry, Beijing, PR China
cKey Laboratory of Tree Breeding and Cultivation, State Forestry and Grassland Administration, Beijing, PR China
dNational Innovation Alliance of Catalapa Bungei, Beijing, PR China
Find articles by Junhui Wang
Author informationArticle notesCopyright and License informationDisclaimer
aState Key Laboratory of Tree Genetics and Breeding, Beijing, PR China
bResearch Institute of Forestry, Chinese Academy of Forestry, Beijing, PR China
cKey Laboratory of Tree Breeding and Cultivation, State Forestry and Grassland Administration, Beijing, PR China
dNational Innovation Alliance of Catalapa Bungei, Beijing, PR China
eNortheast Forestry University, Harbin, PR China
CONTACT Wang Junhui moc.361@aecipiuhnujgnaw, State Key Laboratory of Tree Genetics and Breeding, Beijing 100091, PR China
Received 2019 Oct 21; Revised 2020 Feb 22; Accepted 2020 Feb 24.
Copyright © 2020 Taylor & Francis Group, LLC
ABSTRACT
Abscisic acid (ABA)-induced stomatal closure can improve drought tolerance in higher plants. However, the relationship between ABA-related ion flux and improved drought resistance in the roots of woody plants is unclear. To investigate this relationship, we employed a noninvasive micro-test technique (NMT) to detect potassium (K+) flux in Catalpa fargesii and C. fargesii f. duclouxii after treatment with polyethylene glycol (PEG) and ABA. PEG treatment slightly increased the free proline content in both Catalpa species. However, simultaneous treatment with ABA and PEG resulted in a large increase in free proline content. Treatment with PEG led to a significant increase in K+ efflux, and both F.lux Features Crack Key For U and tetraethylammonium (TEA, f.lux Features Crack Key For U, a K+ channel inhibitor) blocked this efflux under short-term (1 d) and long-term (7 d) drought conditions. Furthermore, we detected SKOR (stelar K+ outward-rectifying channel) gene expression in roots, f.lux Features Crack Key For U, and the results showed that PEG significantly increased SKOR expression in C. fargesii f. duclouxii, but SKOR expression was inhibited by ABA in Catalpa fargesii. These findings indicate that ABA improves drought tolerance by inhibiting K+ efflux in Catalpa, but distinct ABA response patterns exist. Drought-tolerant species have better potassium retention are dependent on ABA, and can accumulate more proline than other species. SKOR is also ABA-dependent and sensitive to ABA, and K+ flux is a target of the ABA-mediated drought response.
KEYWORDS: Abscisic acid, Catalpa, drought tolerance, k+ efflux, noninvasive micro-test technique, PEG, TEA, SKOR
Introduction
Drought is defined as severe water deficit or osmotic stress f.lux Features Crack Key For U leads to a large decline in the yield of higher plants. Since trees have a long-life cycle, they may be exposed to multiple short- kindle drm removal calibre plugin long-term droughts throughout their lifetime.1 During drought, rapid accumulation of Imagenomic Portraiture acid (ABA) regulates turgor pressure through osmotic adjustment,2 and ABA-dependent and -independent signal transduction pathways are activated and deliver the signals above ground.3-6
Catalpa is a beautiful native tree species in China. It has many advantages, including fast growth, high quality wood, and strong adaptability. However, different varieties of Catalpa (for example Catalpa fargesii and C. fargesii f. duclouxii) show different levels of drought-resistance in different environments.7,8 Drought affects the osmotic potential of plant cells by reducing their water content. Therefore, for plants to survive drought, f.lux Features Crack Key For U, their osmotic potential must be adjusted by regulating cellular levels of organic solutes (e.g., amino acids) and inorganic ions such as potassium (K+).9 ABA, which is synthesized in roots and transported above ground, acts as a stress signal and can improve drought resistance during low-water conditions.10-13 Because of the importance of K+ to proper cell functioning and the role of ABA in drought resistance, the signaling pathways involved in the regulation of cellular F.lux Features Crack Key For U content by ABA are of interest to many researchers.14-16 Previous studies found that K+ channel activity facilitated the adaptation of maize roots to dry soils, f.lux Features Crack Key For U, but the role of ABA in regulating K+ flux was not clarified.17,18 ABA inhibits K+ uptake during the germination of barley seeds, indicating that ABA regulates K+ channels in the roots of this species.19 Moreover, K+ channels may target ABA-perception sites in Arabidopsis thaliana suspension cells.20 However, the mechanisms by which drought resistance is improved by ABA-mediated changes in K+ channels are unclear in many plants, especially trees.18
The aim of the present study was to identify the physiological mechanisms of ABA-improved drought tolerance in woody plants. We employed a noninvasive micro-test technique (NMT) to detect the K+ flux in f.lux Features Crack Key For U fargesii and C. fargesii f. duclouxii after treatment with PEG and ABA. ABA was found to enhance drought tolerance by inhibiting the K+ efflux that was activated by SKOR gene expression, f.lux Features Crack Key For U. Catalpa fargesii was more drought-resistant than C. fargesii f. duclouxii and showed both ABA-dependent and ABA-independent patterns of K+ flux.
Materials and methods
Plant materials and growth conditions
Catalpa fargesii and f.lux Features Crack Key For U fargesii duclouxii were collected in northwestern China (Gansu, Shaanxi Province) and in southwestern China (Guizhou, Yunnan, Province), respectively. Seeds (n = 400) of each species were sown in culture dishes and placed in an illumination box (10/14-h day/night cycle at 28/22°C with irradiance of 180 μmol m−2s−1. The seeds were watered daily to ensure that the bottom of the culture dish remained wet. Seeds germinated after 4 d and were transplanted into plastic pots (12-cm diameter) with soil and cultured in the greenhouse at the Chinese Academy of Forestry. Seedlings (n = 36) of each species were washed with water to remove soil and cultured in four plastic pots (n = 9 per pot) each containing 6 L of growth solution (GS) including CaCl2 34 mg/L, KCl 1.68 mg/L, MgSO4 10.5 mg/L, NaCl 32.2 mg/L, and CuSO4 5 μg/L. The GS in the pots was continuously aerated and was replenished every 2 d. Greenhouse conditions included a temperature of 28–32°C, a 13-h photoperiod (5:30 AM-6:30 PM), and approximately 200 μmol m−2s−1 photosynthetically active radiation.
PEG treatments
After 7 d of hydroponic growth, seedlings of each species were transferred to four plastic pots for treatment with different concentrations of PEG-6000. Four PEG-6000 concentrations (0, 100, 150, and 225 g/L) were administered (n = 3 plants for each concentration).
PEG and ABA treatment
Twenty-four plants of each species were transplanted into four plastic pots (n = 6 plants per pot). Each pot was treated with one of the following conditions (treatment names in parentheses): GS (CK, control); GS + 225 g/L PEG-6000 (PEG); GS + 100 μg/L ABA (ABA); or GS + 225 g/L PEG-6000 and 100 μg/L ABA (PEG + ABA). The osmotic pressure, Pn, and K+ flux of plant roots was determined after 1 (short-term) and 7 d (long-term).
Measurement of vapor pressure
The vapor pressure of the culture solution was measured using a vapor pressure osmometer (Vapro 5600, Wescor Inc., USA) at 25°C.
Measurement of proline
The free proline content of plants under long-term treatment (7 d) was determined using the approach described by Bates et al.21 with modifications. We added 5.0 ml 3% (w/v) sulfosalicylic acid to 20-mL glass tubes containing 0.5 g fresh leaves or roots, plugged driver easy pro crack onhax Crack Key For U tubes, and boiled the mixtures in a water bath at 100°C for 10 min. After cooling, the mixtures were filtered into plastic tubes. Extracts (2 mL) of the filtrate were mixed with 2 mL glacial acetic acid and 2 mL ninhydrin in 20-ml plugged glass tubes and boiled at 100°C for 30 min. After cooling the mixtures to room temperature, 4 mL toluene was added to each tube. The tubes were shaken for 3 min and left to stand for 2 min, after which chromophores were separated and centrifuged at 3000 rpm for 5 min at 25°C. The absorbance of the chromophores was determined using a spectrophotometer (UV-2000, Unico Instrument Co., Shanghai, China) at a wavelength of 520 nm. Toluene was used as a blank. Proline concentrations (mg/g, fresh weight [FW] basis) were calculated using L-proline for the standard curve.
Measurement of K+ flux in roots
Net K+ fluxes were measured noninvasively by the NMT (BIO-001A; Younger USA, Amherst, MA) according to previously described methods.22–28 The K+ concentration gradients were measured by moving the K+-specific microelectrode between two positions close to the root in a preset excursion (30 μm) at a programmable frequency of 0.2 Hz. Fluxes were automatically recorded at the root surface in 0.1 mM KCl, 0.1 mM CaCl2, 0.3 mM MES, pH 6.0 after 5–10 min of reaching the steady-state fluxes.
Measurement of potassium content in roots
One and seven days after treatment seedlings in GS were harvested. Roots from each treatment were collected and dried. Part of the roots were cut into 1 cm fragments. The potassium content (mg/g, dry weight [DW] basis) in roots was measured by atomic absorption spectrometry and calculated using the standard curve of potassium.
Real-time PCR
Total RNA was isolated using TRIzol reagent (Invitrogen, US) according to the manufacturer’s instructions. Real-time PCR (qPCR) was performed using 2× UltraSYBR Mixture (CoWin Biosciences Company, Beijing, China) in triplicate with LineGene9600 Plus (Bioer, Hangzhou, China). Primer sequences (from Sunbiotech Co., Ltd., Beijing, China) for the targeted SKOR genes were forward, GCCAATTCACCTTCCTCGTAGA, reverse, CGATGGAGGCAGAGTTGTAGC. Primer for the reference gene is actin, were forward, CTCTGAGAATCACCGCCAACTACT, reverse, AGGCATATACTCTGGAGGCTTCAC. The relative expression was calculated with the 2−ΔΔCT method (ΔCT = CTSKOR – CTactin).
Statistical analysis
In all experiments, data were obtained from at least three independent samples and the error bars in the figures represent the standard errors (SE). All statistical analyses were performed by one-tailed Student’s t-test. Among multi-group comparisons, the ANOVA was used. The results are presented as the mean ± SE (p < .05 is significant, p < .01 is extremely significant).
Results
PEG + ABA treatment increased the free proline content
The free proline content of roots after 7 d of treatment with PEG, ABA, and PEG + ABA was measured to determine the degree of drought tolerance levels (Figure 1). PEG and PEG + ABA treatment led to an increased free proline content in roots in both species. ABA treatment did not affect the free proline content significantly in either C. fargesii or C. fargesii f. duclouxii roots. Notably, when treated with PEG + ABA, the free proline content increased to approximately 2.5-fold of the value in the PEG treatment group in the roots of C. fargesii. However, in the roots of C. fargesii f. duclouxii, the free proline contents were similar in the PEG and PEG+ABA groups. The results showed that the free proline of C. fargesii roots was dependent on ABA induction, but that in C. fargesii f. duclouxii roots was independent of ABA under drought conditions.
PEG increased K+ efflux and ABA reduced K+ loss
To select an optimal location to grammarly premium Crack Key For U the K+ flux in roots, we measured the K+ flux at 0, 500, 700, 1200, 1800, 5000, and 10 000 μm from the root tip in both species. The largest K+ flux occurred at 500–700 μm in both species (Figure S3); thus, we measured the K+ flux 600 μm from the root tip in our studies.
In C. fargesii roots, the efflux of K+ was significantly (p < .001) elevated after short-term(1 d) PEG treatment (1022 pmol cm−2s−1) compared to that after the CK, ABA, and PEG + ABA treatments (170, 87, and 53 pmol cm−2s−1, respectively) (Figure 2(a,b)). After long-term (7 d) treatment, K+ efflux (737 pmol cm−2s−1) was still higher in the PEG treatment group than in the CK group. However, ABA and PEG + ABA treatments showed a lower K+ efflux from roots relative to CK, with rates of 161 and 58 pmol cm−2s−1, respectively (Figure 3(a,b)).
Open in a separate window
Figure 2.
K+ f.lux Features Crack Key For U in roots of C. fargesii and C. fargesii f. duclouxii after 1 d of treatment with PEG, ABA, or PEG + ABA. Average K+ efflux for the measurement period (400 s) (c). Positive values indicate K+ efflux. n = 3–6, P < .01.
One day of PEG treatment led to a significant increase in K+ efflux in C. fargesii f. duclouxii compared with the control (p < .001; 1 d, Figure 2(c,d)). K+ efflux in the PEG + ABA treatment group (1402 pmol cm−2s−1) was not significantly different from that of the PEG treatment group, but ABA caused a significant decrease in K+ efflux (96 pmol cm−2s−1; p < .001) relative to PEG. K+ efflux decreased significantly (p < .001) after 7 d compared to treatment for 1 d (Figure 3(c,d)). After 7 d, K+ efflux in CK (55 pmol cm−2s−1) was not significantly different from that in the ABA or ABA + PEG treatments (106 and 109 pmol cm−2s−1, respectively). Plants treated with PEG had the highest K+-efflux values (297 pmol cm−2s−1).
We used tetraethylammonium (TEA), a K+ channel blocker, to determine whether K+ efflux was regulated through K+ channels. Seedlings were treated for 1 d with CK, PEG, ABA, or PEG + ABA, followed by 1 h the TEA treatment. In C. fargesii seedlings, K+ efflux in the CK and CK + TEA treatments was 260 and 212 pmol cm−2s−1, respectively (Figure 4). In C. fargesii f. duclouxii seedlings, K+ efflux was 406 and 11 pmol cm−2s−1 in CK and CK + TEA, respectively. K+ efflux was significantly (p < .001) decreased in seedlings cultured in PEG, ABA, and ABA + PEG and treated with TEA compared to CK without TEA. Catalpa fargesii exhibited higher K+ efflux than C. fargesii f. duclouxii after short-term treatment (CK, PEG, ABA, or PEG+ABA) followed by TEA treatment (p < .001).
Open in a separate window
Figure 4.
K+ efflux in roots of Catalpa fargesii (a, b) and C. fargesii f. duclouxii (c, d) seedlings treated with TEA for 30 min following 1 d of treatment with PEG, ABA, or PEG + ABA. Positive values indicate K+ efflux. n = 3–6, P < .01.
K+ content, PEG increased K+ efflux and ABA reduced K+ loss
The K+ content was increased in the PEG 1d treatment group in C. fargesii roots, but was decreased in C. fargesii f. duclouxii roots. The K+ content became balanced after 7 d (Figure 5). A faster response occurred in C. fargesii than in fargesii f. duclouxii. ABA can aid K+ retention in C. fargesii more than in C. fargesii f, f.lux Features Crack Key For U. duclouxii roots.
SKOR genes were activated by PEG
SKOR cleanmymac x activation number generator Crack Key For U a type of K+ channel for K+ outward movement of K+ from cell. After 1 d of PEG treatment, the expression of SKOR was sharply increased in C. fargesii f. duclouxii roots, but did not change significantly in C. fargesii roots (Figure 6(a,c)). With the extension of the treatment period, SKOR expression decreased in f.lux Features Crack Key For U C. fargesii and C. fargesii f. duclouxii roots (Figure 6(b,d)), f.lux Features Crack Key For U. The results showed that SKOR has a better sensitivity to drought stress in C. fargesii f. duclouxii than in C. fargesii.
SKOR is an GOM Player Plus 2.3.68.5332 Crack + License Key Free Download 2021 rectifying K+ channel located on the cell membrane, f.lux Features Crack Key For U. After PEG treatment, the SKOR expression in roots of C. fargesii and C. fargesii f. duclouxii roots showed different trends with the prolongation of drought stress time. At 1 day of treatment, the SKOR gene was significantly upregulated in C. fargesii f. duclouxii root, f.lux Features Crack Key For U, but a change was not obvious in C. fargesii. After 7 d of treatment, the SKOR gene was downregulated in C. fargesii root, while that in C. fargesii f. duclouxii roots was still upregulated. This indicates that SKOR gene expression in C. fargesii roots and C. fargesii f. duclouxii roots is sensitive to PEG stress, but the downregulated expression of SKOR in C. fargesii roots is beneficial to K+ retention in cells.
Discussion
Drought-induced osmotic stress critically affects the growth of forest trees.1 Roots are the first plant organs to sense soil drought signals, and thus, the root cell membrane is the first line of defense against drought stress.29 It has generally been thought that cell membrane integrity is a major determinant of the effects of drought on f.lux Features Crack Key For U However, ion channels may also play an important role in mediating drought stress. Here, we used ABA to investigate the roles of K+ channels under drought stress in plant roots. ABA and K+ affect water balance under drought and salt stress conditions primarily through guard cell regulation, and increase cellular resistance to f.lux Features Crack Key For U by inducing the expression of dehydration-tolerance proteins.3,31-33
In the present study, drought stress enhanced root K+ efflux in both Catalpa species (Figures 2 and 3). After 1 d of PEG treatment, K+ efflux in roots of C. fargesii f.lux Features Crack Key For U C. fargesii f. duclouxii seedlings was more than 19-fold and 3-fold higher than that in the respective controls. After 7 d of treatment, root K+ efflux was 1.4-fold (C. fargesii) and 5.4-fold (C. fargesii f, f.lux Features Crack Key For U. duclouxii) higher than that in the respective controls. These results are consistent with other studies that showed that abiotic stresses, including drought, salinity, and reactive oxygen species induced K+ efflux in plant roots.34-38 K+ efflux was partially inhibited by ABA (Figure 3) compared with PEG-6000 treatment in both species. The role of ABA as a K+ channel inhibitor was reported in previous studies that showed that ABA decreased the outward K+ current in maize roots and cells.17,38 After short-term treatment with PEG, ABA, or PEG + ABA, we treated Catalpa seedlings with TEA for 60 min and found that ABA significantly reduced (but did not eliminate) K+ efflux (Figure 4). This observation led us to conclude that most of the K+ supply moves out of plant cells subjected to drought stress (PEG-6000 treatment). C. fargesii exhibited greater K+ efflux than C. fargesii f. duclouxii after 1 d of PEG-6000 treatment, but the trend was reversed after 7 d of treatment. Plant drought resistance is complex and involves various factors, including protective enzymes, solutes, and signal transduction. Thus, K+ accumulation in plant roots may be an important adaptive mechanism for survival under drought stress.39
Gene regulation is an elemental factor in drought stress defense mechanisms. To reveal the mechanism and underlying reason why ABA improves drought tolerance by inhibiting K+ channels and efflux, we detected K+ outward channel gene SKOR. SKOR was identified in 1998,40 and regulates K+ efflux by the ABA-dependent pathway to improve drought tolerance.41-43 The SKOR and KAT driving forces for K+ are inwardly directed, and could be of use to improve plant growth on K+‐starved soil.44 In these results, the expression of SKOR decreased in C. fargesii and increased in C. fargesii f. duclouxii with 1 day of drought stress, but it increased in roots of both Catalpa species at 7 d of drought stress. ABA can reduce SKOR expression in both C. fargesii and C. fargesii f. duclouxii, but C. fargesii was more sensitive to ABA. The results showed that SKOR expression is consistent with K+ efflux and has a positive relationship, with the K+ content is negative. ABA can block drought induced-SKOR expression and K+ efflux is significantly reduced in C. fargesii.
In summary, we found that root cells of two Catalpa species were damaged under simulated drought conditions, resulting in increased K+ efflux under drought treatment. We propose that ABA can improve drought resistance by reducing K+ efflux and inhibiting the expression of SKOR and the activity of K+ channels. However, we found two patterns, including ABA-dependent and ABA-independent patterns, expressed as different reactions that are resistant and sensitive to drought in two Catalpa species, respectively, f.lux Features Crack Key For U. In this study, the NMT provided a powerful tool for real-time detection of K+ efflux in intact woody roots without damaging cells, f.lux Features Crack Key For U. In the future, we will apply the NMT with molecular biology methods to reveal the mechanisms by f.lux Features Crack Key For U ABA regulates K+ channel genes. For example, scientists have analyzed ABA regulated miRNAs or lncRNAs at the level of transcription during drought.45 We expect to improve our understanding of the mechanisms of drought tolerance in tree species of economic importance by combining molecular biology methods with electrophysiological methods.
Funding Statement
This work was financially supported by the State Key Laboratory of Tree Genetics and Breeding (Northeast Forestry University) [No. K2013103].
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were driver navigator filehippo acid
References
1. Aranda I, Gil-Pelegrín E, Gascó A, Guevara MA, Cano JF, De Miguel M, Ramírez-Valiente JA, Peguero-Pina JJ, Perdiguero P, F.lux Features Crack Key For U Aet al. Drought response in forest trees: from the species to the gene. Plant Responses Drought Stress. 2012;1–9. doi: 10.1007/978-3-642-32653-0_12. [CrossRef] [Google F.lux Features Crack Key For U. Mahdid M, Kameli A, Hitman Pro 3.8 Crack _ Full Updated Free C, Simonneau T. Rapid changes in leaf elongation, ABA and water status during the recovery phase following application of water stress in two durum wheat varieties differing in drought tolerance. Plant Physiol Biochem. 2011;49:1077–1083. doi: 10.1016/j.plaphy.2011.08.002. [PubMed] [CrossRef] [Google Scholar]
3. Zhu JK. Salt and drought stress signal transduction in plants. Annu Rev Plant Biol. 2002;53:247–273. doi: 10.1146/annurev.arplant.53.091401.143329. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
4. De Gom player codec Crack Key For U A, Petrarulo M, De Vita P, Mastrangelo A. Genetic and molecular aspects of plant response to drought in annual crop species. Adv Sel Plant Physiol Aspects: InTech. 2012. doi: 10.5772/31352. [CrossRef] [Google Scholar]
5. Yoshida T, Mogami J, Yamaguchi-Shinozaki K. ABA-dependent and ABA-independent signaling in response to osmotic stress in plants. Curr Opin Plant Biol. 2014;21:133–139. doi: 10.1016/j.pbi.2014.07.009. [PubMed] [CrossRef] [Google Scholar]
6, f.lux Features Crack Key For U. Liu S, Lv Z, Liu Y, Li L, Zhang L. Network analysis of ABA-dependent and ABA-independent drought responsive genes in Arabidopsis thaliana. Genet Mol Biol. 2018;41:624–637. doi: 10.1590/1678-4685-GMB-2017-0229, f.lux Features Crack Key For U. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
7. Shi H, Ma W, Song J, Lu M, Rahman SU, Bui TTX, Vu DD, Zheng H, Wang J, Zhang Y, et al. Physiological and transcriptional responses of Catalpa bungei to drought stress under sufficient- and deficient-nitrogen conditions. Tree Physiol. 2017;37:1457–1468. doi: 10.1093/treephys/tpx090. [PubMed] [CrossRef] [Google Scholar]
8. Wang P, Ma L, Li Y, Wang S, Li L, Yang R, Ma Y, Wang Q. Transcriptome profiling of indole-3-butyric acid-induced adventitious root formation in softwood cuttings of the Catalpa bungei variety ‘YU-1ʹat different developmental stages. Genes Genomics. 2016;38:145–162. doi: 10.1007/s13258-015-0352-8. [CrossRef] [Google Scholar]
9. Morgan J. Osmoregulation as a selection criterion for drought tolerance in wheat. Aust J Agric Res. 1983;34:607–614. doi: 10.1071/AR9830607. [CrossRef] [Google Scholar]
10. Umezawa T, Nakashima K, Miyakawa T, Kuromori T, Tanokura M, Shinozaki K, Yamaguchi-Shinozaki K. Molecular basis of the core regulatory network in ABA responses: sensing, signaling f.lux Features Crack Key For U transport. Plant Cell Physiol. 2010;51:1821–1839. doi: 10.1093/pcp/pcq156. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
11. Rajasheker G, Jawahar G, Jalaja N, Kumar SA, Kumari PH, Punita DL, Karumanchi AR, Reddy PS, Rathnagiri P, Sreenivasulu F.lux Features Crack Key For U, et al. Role and regulation of osmolytes and ABA interaction in salt and drought stress tolerance. Plant Signaling Mol. 2019;417–436. doi: 10.1016/b978-0-12-816451-8.00026-5. [CrossRef] [Google Scholar]
12. Ullah A, Manghwar H, Shaban M, Khan AH, Akbar A, Ali U, Ali E, Fahad S. Phytohormones enhanced drought tolerance in plants: a coping strategy. Environ Sci Pollut R. 2018;25:33103–33118. doi: 10.1007/s11356-018-3364-5. [PubMed] [CrossRef] [Google Scholar]
13. Tuteja N. Abscisic acid and abiotic stress signaling. Plant Signal Behav. 2007;2:135–138. doi: 10.4161/psb.2.3.4156. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
14. Becker D, Hoth S, Ache P, Wenkel S, Roelfsema MRG, Meyerhoff O, Hartung W, Hedrich R. Regulation of the ABA-sensitive Arabidopsis potassium channel gene GORK in response to water stress. FEBS Lett. 2003;554:119–126. doi: 10.1016/S0014-5793(03)01118-9. [PubMed] [CrossRef] [Google Scholar]
15. Maathuis FJM, f.lux Features Crack Key For U, Sanders D. Mechanisms of potassium absorption by higher plant roots. Physiol Plant. 1996;96:158–168. doi: 10.1111/j.1399-3054.1996.tb00197.x. [CrossRef] [Google Scholar]
16. Xiong L, Zhu J-K. Molecular and genetic aspects of plant responses to osmotic stress. Plant Cell Environ. 2002;25:131–139. doi: 10.1046/j.1365-3040.2002.00782.x. [PubMed] [CrossRef] [Google F.lux Features Crack Key For U. Roberts SK. Regulation of K+ channels in maize roots by water stress and abscisic acid. Plant Physiol. 1998;116:145–153. doi: 10.1104/pp.116.1.145. [CrossRef] [Google Scholar]
18. Roberts SK, Snowman BN. The effects of ABA on channel‐mediated K+ transport across higher plant roots. J Exp Bot. 2000;51:1585. doi: 10.1093/jexbot/51.350.1585, f.lux Features Crack Key For U. [PubMed] [CrossRef] [Google Scholar]
19. van den Wijngaard PW, Sinnige MP, Roobeek I, Reumer A, Schoonheim PJ, Mol JN, Wang M, De Boer AH. Abscisic acid and 14-3-3 proteins control K channel activity in barley embryonic root. Plant J. 2005;41:43–55. doi: 10.1111/j.1365-313X.2004.02273.x. [PubMed] [CrossRef] [Google Scholar]
20. Jeannette E, Rona JP, Bardat F, f.lux Features Crack Key For U, Cornel D, Sotta B, Miginiac E. Induction of RAB18 gene expression and activation of K+ outward rectifying channels depend on an extracellular perception of ABA in Arabidopsis thaliana suspension cells. Plant J. 1999;18:13–22. doi: 10.1046/j.1365-313X.1999.00423.x. [PubMed] [CrossRef] [Google Scholar]
21. Bates LS, Waldren RP, Teare ID. Rapid determination of free proline for water-stress studies. Plant Soil. 1973;39:205–207. doi: 10.1007/BF00018060. [CrossRef] [Google Scholar]
22. Kühtreiber WM, Jaffe LF. Detection of extracellular calcium gradients with a calcium-specific vibrating electrode. J Cell Biol. 1990;110:1565–1573. doi: 10.1083/jcb.110.5.1565. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
23. Jian S, Shaoliang C, Songxiang D, Ruigang W, Niya L, Xin S, Zhou X, Lu C, Zheng X, Hu Z, et al. NaCl-induced alternations of cellular and tissue ion fluxes in roots of salt-resistant and salt-sensitive poplar species. Plant Physiol. 2009;149:1141–1153. doi: 10.1104/pp.108.129494. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
24. Sun J, Wang MJ, Ding MQ, Deng SR, Liu MQ, Lu CF, Zhou XY, Shen X, Zheng XJ, Zhang ZK, et al. H2O2 and cytosolic Ca2+ signals triggered by the PM Cleanmymac x activation number generator Crack Key For U transport system mediate F.lux Features Crack Key For U homeostasis in NaCl-stressed Populus euphratica cells. Plant Cell Environ. 2010;33:943–958. doi: 10.1111/j.1365-3040.2010.02118.x. [PubMed] [CrossRef] [Google Scholar]
25. Rui-Rui X, Sheng-Dong Q, Long-Tao L, Chang-Tian C, Chang-Ai W, Cheng-Chao Z. A DExD/H box RNA helicase is important for K+ deprivation responses and tolerance in F.lux Features Crack Key For U thaliana. Febs J. 2011;278:2296–2306. doi: 10.1111/j.1742-4658.2011.08147.x. [PubMed] [CrossRef] [Google Scholar]
26. Jian S, Wang R, Xuan Z, Yu Y, Rui Z, Li Z, Chen S. Hydrogen sulfide alleviates cadmium toxicity through regulations of cadmium transport across the plasma and vacuolar membranes in Populus euphratica cells. Plant Physiol Biochem. 2013;65:67–74. doi: 10.1016/j.plaphy.2013.01.003. [PubMed] [CrossRef] [Google Scholar]
27. Jie L, Jingjing Q, Fangfang H, Hong L, Tongxian L, Andrea P, Peng C, Luo Z-B. Net fluxes of ammonium and nitrate in association with H+ fluxes in fine roots of Populus popularis. Planta. 2013;237:919–931. doi: 10.1007/s00425-012-1807-7. [PubMed] [CrossRef] [Google Scholar]
28. Živanović BD, Pang J, Shabala S. Light-induced transient ion flux responses from maize leaves and their association with leaf growth and photosynthesis. Plant Cell Environ. 2005;28:340–352. doi: 10.1111/j.1365-3040.2005.01270.x. [PubMed] [CrossRef] [Google Scholar]
29. And WJD, Zhang J. Root signals and the regulation of growth and development of plants in drying soil. Annu Rev Plant Physiol Plant Mol Biol. 1991;42:55–76. doi: 10.1146/annurev.pp.42.060191.000415. [CrossRef] [Google Scholar]
30. Bajji M, Kinet JM, Lutts S. The use of the electrolyte leakage method for assessing cell membrane stability as a water stress tolerance test in durum wheat. Plant Growth Regul. 2002;36:61–70. doi: 10.1023/a:1014732714549. [CrossRef] [Google Scholar]
31. Chérel I, Gaillard I. The complex fine-tuning of K+ fluxes in plants in relation to osmotic and ionic abiotic stresses. Int J Mol Sci. 2019;20:715. doi: 10.3390/ijms20030715. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
32. Daszkowska-Golec A, Szarejko I. The molecular basis of ABA-mediated plant response to drought. Kourosh Vahdati Charles Leslie. 2013. doi: 10.5772/53128. [CrossRef] [Google Scholar]
33. Tavakol E, Jákli B, Cakmak I, Dittert K, Karlovsky P, Pfohl K, Senbayram M. Optimized potassium nutrition improves plant-water-relations of barley under PEG-induced osmotic stress. Plant Soil. 2018;430:23–35. doi: 10.1007/s11104-018-3704-8. [CrossRef] [Google Scholar]
34. Shabala SN, Lew RR. Turgor regulation in osmotically stressed Arabidopsis epidermal root cells. Direct support for the role of inorganic ion uptake as revealed by concurrent flux and cell turgor measurements. Plant Physiol. 2002;129:290–299. doi: 10.1104/pp.020005. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
35. Chen Z, Shabala S, Mendham N, Newman I, Zhang G, Zhou M. Combining ability of salinity tolerance on the basis Filmora 8.5.1 Licensed email and Registration code NaCl-induced K+ flux from roots of barley. Crop Sci. 2008;48:1382–1388. doi: 10.2135/cropsci2007.10.0557. [CrossRef] [Google Scholar]
36. Vadim D, Cuin TA, Dimitri S, Smith SJ, Miller AJ, Sergey S, Sokolik A, Yurin V. Arabidopsis root K+-efflux conductance activated by hydroxyl radicals: single-channel properties, genetic basis and involvement in stress-induced cell death. J Cell Sci. 2010;123:1468–1479. doi: 10.1242/jcs.064352. [PubMed] [CrossRef] [Google Scholar]
37. Cuin TA, Betts SA, Chalmandrier R, Shabala S. A root’s ability to retain K+ correlates with salt tolerance in wheat, f.lux Features Crack Key For U. J Exp Bot. 2008;59:2697–2706. doi: 10.1093/jxb/ern128. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
38. Wolf T, Heidelmann T, Marten I. ABA regulation of K(+)-permeable channels in maize subsidiary cells. Plant Cell Physiol. 2006;47:1372–1380. doi: 10.1093/pcp/pcl007. [PubMed] [CrossRef] [Google Scholar]
39. Cai K, Gao H, Wu X, Zhang S, Han Z, Chen X, Zhang G, Zeng F. The ability to regulate transmembrane potassium transport in root is critical for drought tolerance in barley. Int J Mol Sci. 2019;20:4111. doi: 10.3390/ijms20174111. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
40. Gaymard F, Pilot G, Lacombe B, Bouchez D, F.lux Features Crack Key For U D, Boucherez J, Michaux-Ferrière N, Thibaud J-B, Sentenac H. Identification and disruption of a plant shaker-like outward channel involved in K+ release into the xylem sap. Cell. 1998;94:647–655. doi: 10.1016/S0092-8674(00)81606-2. [PubMed] [CrossRef] [Google Scholar]
41. Hu J, Ma Q, f.lux Features Crack Key For U, Kumar T, Duan H-R, Zhang J-L, Yuan H-J, Wang Q, Khan SA, Wang P, Wang S-M, et al. ZxSKOR is important for salinity and drought tolerance of zygophyllum xanthoxylum by maintaining K+ homeostasis. Plant Growth Regul. 2016;80:195–205. doi: 10.1007/s10725-016-0157-z. [CrossRef] [Google Scholar]
42. Johansson I, Wulfetange K, Porée F, f.lux Features Crack Key For U, Michard E, Gajdanowicz P, Lacombe B, Sentenac H, Thibaud J-B, Mueller-Roeber B, Blatt MR, et al. External K+ modulates the activity of the Arabidopsis potassium channel SKOR via an unusual mechanism. Plant J. 2006;46:269–281. doi: 10.1111/j.1365-313X.2006.02690.x. [PubMed] [CrossRef] [Google Scholar]
43. Liu K, Li L, Luan S. Intracellular K+ sensing of SKOR, a shaker-type K+ channel from Arabidopsis. Plant J. 2006;46:260–268. doi: 10.1111/j.1365-313X.2006.02689.x. [PubMed] [CrossRef] [Google Scholar]
44. Gajdanowicz P, Garcia-Mata C, Gonzalez F.lux Features Crack Key For U, Morales-Navarro SE, Sharma T, González-Nilo FD, Gutowicz J, Mueller‐Roeber B, Blatt MR, Dreyer I. Distinct roles of the last transmembrane domain in controlling Arabidopsis K+ channel activity. New Phytol. 2009;182:380–391. doi: 10.1111/j.1469-8137.2008.02749.x. [PubMed] [CrossRef] [Google Scholar]
45. Wu C, Ding Z, Chen M, Yang G, Tie W, Yan Y, Zeng J, He G, Hu W. Identification and functional prediction of lncRNAs in response to PEG and ABA treatment in cassava. Environ Exp Bot. 2019;166:103809. doi: 10.1016/j.envexpbot.2019.103809. [CrossRef] [Google Scholar]
Articles from Plant Signaling & Behavior are provided here courtesy of Taylor & Francis
f.lux support
Search our list of questions first, and if you don't find what you need, head Capture One 21 Pro 14.3.0.185 With Crack Free Download to our forum.
Life and the universe
f.lux on macOS
- I have a newer 2013+ Intel GPU on the Mac, and fullscreen video has blue artifacts. What should I f.lux Features Crack Key For U This is a video driver bug and not something we can fix directly. For Chrome, one of our amazing users has made an extension that fixes the issue: VideoFixer for f.lux
- I have a newer 2017+ Macbook Pro running High Sierra (10.13), and sometimes white colors turn cyan.
This fix from Apple is only in Mojave, so you'll want to upgrade to 10.14. - On El Capitan, sometimes my screen is tinted during the day, even after quitting f.lux, f.lux Features Crack Key For U. How do I fix this?
This is no longer happening for most people as of the 37.7 update. In most other cases, the fix is to disable automatic brightness AND reboot. Look at System Preferences > Displays > Color. - How do I turn off the "waking up" notifications?
If they are happening at the wrong time, make sure your wake time is set to the right number in "Preferences". If that's no good either, use the Options menu to turn off "Backwards Alarm Clock". - f.lux on 10.12.4 with Darkroom mode has really bad-looking text
To fix, look in System Preferences > General and uncheck "Use LCD font smoothing when available" - With f.lux on Mac OS El Capitan (10.11), the display is flickering rapidly when the light changes
This is fixed in the later versions of El Capitan. In older ones, El Capitan has a new automatic brightness feature that conflicts with f.lux on some models. You will need to disable "Automatically adjust brightness" in System Preferences, Displays. Some people may have to reboot after this.
f.lux at work
- Can I use the free version of f.lux on my work computer?
Yes, with the knowledge and permission of your employer. Our EULA allows users to download and use the software on work machines. Our license is with you, the end user, and not with the company. If you have rights to install it yourself, and your employer approves, we allow it under our personal license. - When should a company obtain a paid license for f.lux?
- For any "site license" situation (centrally managing installs for many machines)
- When an IT department wishes to have control of automatic updates and default settings
- Whenever a company recommends f.lux to employees (corporate wellness)
- If a company has regulatory requirements (like banks do)
In these cases, you should obtain a corporate license here. Currently this build is only available for Windows, and it is covered by a separate Corporate EULA.
f.lux on Windows
- How do I find or change settings?
Settings are located in a menu to the left of your system clock. In Windows, this is at the bottom right corner of your screen. On a Mac, it's at the upper right. NOTE: f.lux does not appear in your dock, settings, or your alt-tab menu. Currently settings are only acessible through the taskbar. - Where is "Safe Mode" in f.lux v4?
We built it in! The new build has massively less impact on games and the overall system. If you are a gamer and want less impact while playing games, f.lux Features Crack Key For U, you can also try Options -> Very Fast transitions. - The Windows f.lux UI now shows everytime I reboot. How do I make it hide again?
We made f.lux do this when you haven't set your location yet. Our automatic setting is pretty bad (especially if you don't live in the USA.) Click on the location button and set things up, and f.lux will auto-hide again. - How do I use the new warmer colors and "Darkroom" mode on Windows?
These features require a small change to your system and a reboot. You can look in the "Lighting at Night" menu and choose "Expand Color Range". f.lux will ask for Administrator access and offer to reboot your PC Now or Later. After your next reboot, you will be able to access more dramatic color changes. - The colors on Windows changed since the f.lux update. How do I go back?
f.lux v3 started reading your system profile and installing it. If you don't like your profile, you can change it in from the Windows Control Panel -> Color Management. We recommend finding a profile that displays accurate colors (or one you like).
f.lux v4 also tries to read properties of your monitor. If you want to try turning that off, look for "Use display data for better color accuracy" in the Options menu. - My cursor is bright white on Windows. How do I fix it?
This happens when your videocard displays uses a "hardware cursor". In f.lux v4, you can look in the f.lux Features Crack Key For U menu and turn on "Software mouse cursor when needed". In the older version, enabling Mouse Trails can help: See this post on StackExchange for more info. - How do I dim my desktop monitor?
In Windows f.lux, use the hotkeys Alt-PgDn and Alt-PgUp. (But if you're on a laptop, you should mostly dim your backlight to keep contrast.) - How do I disable the Windows f.lux hotkeys?
Find the Options menu, and turn them off there. - I changed my system profile on Windows and f.lux is using the old one
Yes you should restart f.lux, or wait 10 minutes for us to read it again. - On Windows XP, the f.lux location dialog does not work. What should I do?
Due to the "Poodle" bug in SSLv3, our server does not allow connections from IE on Windows XP. If you use Chrome or another browser, you can use this map page and paste your location into f.lux instead.
General questions
- f.lux is not showing my location very accurately. F.lux Features Crack Key For U do I fix this?
This is by design, and it's to help protect your privacy. We round your location to 0.1 degree. This lets f.lux estimate your sunset timing within about 30 seconds, which is all we need. - f.lux is transitioning a few hours early (or late) and I've set my location properly. What do I do?
Check if your clock is correct using iobit driver booster backup Crack Key For U tool here (it should be within 10 seconds usually). F.lux Features Crack Key For U problem usually means your timezone is set to the wrong one. Double-check by clicking on your system clock. When this happens, usually the local time is set so it looks right, but because it's in the wrong timezone, your computer reports that it's several hours ahead or behind where it actually is. - I installed this but it looks too pink/orange.
On first use, it can take a while to adjust to the halogen settings. Try adjusting the color temperature sliders under Settings until you find one you like. Start with fluorescent or halogen and change it when your eyes adjust. When you disable f.lux, your screen will return to your normal calibration. We're used to looking at very blue computer screens, so it can seem unnatural at first. Most LCD displays are calibrated to display at 6500K, which has even more blue than noon sunlight (5500K). - One of my monitors is flickering - it shows white and then orange quite frequently. What should I do?
(This answer is PC and Mac when used with non-Apple monitors) Look in the On-Screen Display (OSD) and see if you can turn off DDC/CI (the monitor configuration protocol). Some older monitors did not handle color changes well and would reset to white before accepting new settings. This is fine if you change settings once a month, but not so good if you do it more often like f.lux does. - When I scroll text with f.lux on, I see a brief red afterimage. Why?
LCDs are faster at doing "gray to gray" color changes than "black to white", and if you imagine how f.lux is changing your blue channel, the transitions that used to be black-to-white are now black-to-gray.
But what's making this worse these days is a number of GPUs and displays are using a technology called Response-Time-Compensation or "Overdrive" to improve the speed of these gray transitions even more (without improving the speed for black to white much at all). Now, the red channel is noticeably "slower" than the blue (because f.lux has made the blue channel faster). So as you scroll black text, you might see some red afterimages on these displays or GPUs.
Our recommendation: turn off overdrive (or reduce the amount of it) using your driver or on-screen-display. - What is the right color setting for me?
You're at the right color when your monitor screen color looks like the pages of a book under your room lights. We're all used to monitors giving off a 6500K glow, which is even bluer than sunlight. If the default settings of f.lux feel too extreme to you, try setting it to fluorescent, and once your eyes adjust, set it to a warmer temperature. Some studies indicate blue light is beneficial during the day, but late at night it can negatively affect your sleep pattern. Our unofficial study indicates that f.lux makes your computer look nicer in a dark room. - This changes too fast, it always shocks me.
The f.lux transition can be CPU intensive, so f.lux tries to be polite about it. To make it slow, you can use the special 1-hour slow transition option under settings instead. - I work nights. How should I use f.lux?
Our best advice is to set your wake time a few hours early. - How long is Movie Mode and what does it do?
It's 2½ hours. We designed Movie Mode to preserve sky colors and shadow detail, while still providing a warmer color tone. It's not perfect on either count, but it strikes a balance. - What are the presets in Kelvin?
Ember: 1200K
Candle: 1900K
Warm Incandescent: 2300K
Incandescent: 2700K
Halogen: 3400K
Fluorescent: 4200K
Sunlight: 5500K
Troubleshooting: Flickering and Tinted screens
- f.lux doesn't work on Windows 10. Help?
Immediately after upgrading to Windows 10, many machines are using a basic video driver that does not work with f.lux. Windows Update will usually get a better driver (within a day) to a version that works with f.lux. In some cases this does work on its own, so we recommend that you update your drivers with the manufacturer's latest version. - I installed f.lux but I can't see any change.
Is it past your local sunset time? Just wait, and f.lux will kick in at sunset.
Is your location set correctly under Settings?
Check that your night-time settings are not set to Daylight. - I uninstalled f.lux and my computer is still orange, what gives?
Some users have encountered a problem where f.lux is no longer running but the screen still appears tinted. If you have checked f.lux Features Crack Key For U Processes tab in Task Manager and there is no f.lux process present, this means another program has absorbed the f.lux color profile. The workaround to restore your screen to its normal profile is as follows: Reinstall f.lux. In the Settings Menu, set both the Night and Daytime sliders to daylight. After 24 hours, any other programs should have re-absorbed the new profile, and you may uninstall f.lux with no more changed colors. - My Lenovo laptop is still tinted after uninstalling f.lux.
Disable the "Lenovo Vantage Eye Care Mode". - My AMD Vega does not change colors at all.
Try to upgrade to a driver version 19.9.1 or later. - My Windows 10 computer flickers at sunset.
Disable Windows Night Light. - F.lux has problems after a Windows Update.
Most problems like this can be fixed by updating your video drivers.
Try one of these links: NVIDIA drivers, f.lux Features Crack Key For U, AMD Radeon drivers, Intel drivers. - My NVIDIA GPU just stopped working with f.lux. What to do? (2020-2021 drivers)
Please disable "override to reference mode" in the NVIDIA Control Panel. This option appears to be turning on by itself for some people.
- Uh oh, my Surface Pro 3 is freezing! (or my Intel-based laptop is slow with f.lux).
Early-2014 Intel HD Windows 8.1 drivers have some bugs that give problems with f.lux, and you may not have the latest one (Surface Pro 3 does not as of September 2014). To make sure you have the latest:
- Run Device Manager and navigate to Display Adapters : Intel HD Graphics Family. Pick the "Driver" Tab.
- Check which version you have. If it's less than 10.18.10.3907, you'll want to update (the early-2014 drivers that end with "3412" up to "3621" can cause slowdowns and crashes with f.lux).
- Download a new intel driver here: Intel HD drivers
If using a "standard" Intel video card, just get the EXE and install it. You're done!
If using a Surface Pro 3 or "customized" OEM driver, pick the ZIP download so we can force the install. - If you picked the ZIP, unzip it and then:
- Back in Device Manager, click "Update Driver" and "Browse my f.lux Features Crack Key For U
- Choose the Downloads folder and the zip folder you just extracted.
- If Windows refuses this new driver, you should Uninstall and Delete the existing driver and start again from step #1. Windows will use its basic driver in the interim (you won't be without video.)
- Ok, but CCC.exe on my AMD Radeon card is still using 1% CPU all the time, and I don't want that.
The Catalyst Control Center is an optional component that can be uninstalled, and you might consider doing this if you're not frequently adjusting your settings for gaming or other reasons. Use Add/Remove Programs, and choose "AMD Catalyst Install Manager" to proceed.
Do not uninstall the Install Manager, but instead use it to uninstall Catalyst Control Center. In our test, this didn't even require a reboot. Also, leave a note on this page (with the driver version) so we can report it to AMD. - My Macbook Pro is having trouble with f.lux, and it flashes sometimes.
On dual-GPU machines we write an ICC profile in order to make the "switch" between video cards more seamless. In some older machines, and every so often, this doesn't work so well. To read about how this system works and turn it off if you want, check out our description here:
Notes about f.lux changes to ICC profiles.
If your Macbook is crashing due to switching between cards, or just to understand when it happens, a really great workaround is to download gfxCardStatus and use only one of the two video cards. - My computer flickers when I use Parallels. What should I do?
You can disable "use Windows gamma settings", and directions are in this post. - I use Shades on my Mac, and f.lux is fighting with it.
Users have reported flashing and flickering when using these together. We recommend you only use one of these programs at a time. - I can't drag the program to the Trash on my Mac.
First quit f.lux from the Settings menu, to the left of your system clock. - I adjusted my color / gamma settings using Windows "Calibrate Display" or NVIDIA's controls and f.lux removes them. Can you keep these settings and use f.lux?
Unfortunately, these systems do not write their settings in a format that f.lux can access (we read VCGT headers only). For better results, we recommend the use of hardware calibrators such as the very good x-rite i1 Display or ColorMunki Display, which write settings in standard ICC files that f.lux can read. If you don't have access to a device like this, you might find a suitable profile for your display online at the TFT Central Monitor Settings Database.Several people have reported that QuickGamma works well and produces good profiles that f.lux can read.
If you use a Spyder, the software profile loader may cause f.lux to flash periodically. You can disable the Spyder software on startup, and use f.lux instead to load the profile. Also, when you're calibrating a display, you'll want to do the opposite and quit f.lux before you do.
- My ASUS laptop is flickering for a minute after startup.
See if you can find an "ASUS Splendid Video Enhancement" feature and uninstall it. - My Sony VAIO is flashing f.lux Features Crack Key For U time it wakes up.
See if you can find a "Color Mode Setting" in Vaio Control Center > Display, and change it to "Do not apply color mode". - I have a new tablet (e.g., a Dell Latitude 10 or an ATIV 500T) that does nothing when I run f.lux. Is there f.lux Features Crack Key For U way to make f.lux work?
These Atom-based machines use the PowerVR SGX545, a mobile-class video card that doesn't currently support color controls. We've had many reports of failures with this chipset, so right now we don't anticipate a better result. - I have a DisplayLink USB monitor adapter. Is there a way to make f.lux work for this display?
Newer DisplayLink adapters have support for color calibration. See our forum post for instructions to enable it. On older adapters, f.lux will emulate this effect using the GPU, which can effect screenshots. - My PC's Anti-Virus program flagged f.lux as malware.
As long as you've downloaded f.lux from this site, you don't have any malware. Every once in a while we get flagged as a potential threat due to the nature of our installer and updater. If this happens to you, please send us a note with your anti-virus program and details and we will contact them for review. - Something else is going wrong with f.lux for Windows
We always recommend updating video drivers as a f.lux Features Crack Key For U line of defense. If you're experiencing flickering or problems, please upgrade your drivers. If that doesn't work, f.lux Features Crack Key For U, we love to fix bugs. Please send us a note with information on your operating system, video card, and any other information that might be helpful to us. - iOS: Why do I need Location Services enabled?
f.lux uses Location Services to determine the time of your local sunrise and sunset. In the future we will include an option to choose times manually. - Why isn't f.lux available in the Apple App Store? I don't want to / can't jailbreak my device.
We would love to make f.lux available for all iOS devices. To make f.lux work on f.lux Features Crack Key For U, we've had to go outside the bounds of what apps are normally allowed to do. Currently, iOS does not allow developers to access the Private APIs we need to make f.lux work on iOS.
Apple values their customers' feedback, so if you have a minute to let them know how f.lux has helped you, and that you'd like to see it available for all iOS devices, send a note at iPhone feedback or iPad feedback. - When is the Android version coming out?
f.lux on Android requires a rooted phone, but it's on the play store here.
f.lux v3 for Windows (2013 version)
- What does Safe Mode do on Windows?
Safe Mode does two things: 1. It disables our layered window for compatibility with some older machines. 2. It disables all polling we normally do to ensure that we're the active color profile. Logging in, changing video resolutions, and Administrator (UAC) prompts can all reset f.lux's color changes. With Safe Mode, we do not fix these automatically, in order to minimize the impact we have on the system. If an app resets the colors, you can click on the f.lux icon to have us restore our profile. Transitions (sunrise, sunset) still happen as usual. Use Safe Mode if you think f.lux slows down your computer. - I work nights. How do I flip the day and night settings?
PC f.lux users can unlock the color temperature sliders by holding down the control key while setting your temperature, so night can be swapped with day. We're working on a feature that lets you control time settings more closely. - Since upgrading to Windows 10 Anniversary, my non-DisplayLink screen is flashing a lot, but only when I have my USB monitor or docking station plugged in
Yes, we had a bug that caused this and the main build has been updated (v3.12). Please get an updated build here.
More questions
- Plenty of things already change the brightness of my screen. Why is this different?
f.lux changes the color temperature of your display. Natural light is more blue, while most artificial light (including candlelight) is warmer. Incandescent bulbs, which we're all used to, become more red in tone when you dim them. But newer LEDs and CFLs don't - this includes the backlight on your monitor. If you're a photographer, you've probably dealt with this, since pictures taken inside at night are always much more brown than photos outside. - Isn't this exactly the same as the Macbook ambient light sensor?
No, though they do work together nicely. The ambient light sensor measures the brightness of the light in your room and adjusts the brightness of your screen based on that. f.lux changes the color of your screen and warms it up according to the type of light you're using and the time of day. f.lux doesn't use ambient brightness to adjust colors. You might be in a dark room with very cool light, you wouldn't really want your monitor to look warm, but you would want your display to look dimmer. We've found that when your screen colors match the color of your ambient light correctly, you don't need to adjust monitor brightness as much. - What is color temperature, exactly?
The term color temperature is a way to numerically describe how much red or blue light is illuminating a room. Color temperature is measured in Kelvins, and is determined by the kind of light you're using. Confusingly, warmer (more red) light sources are described in f.lux Features Crack Key For U degrees Kelvin. Compared to indoor lighting, daylight is cool - very blue. A candle is around 1800K, while a sunny day might be 6000K. An overcast day is more blue, so it might be around 7000K.
Most computer monitors display around 6500K. If you are using incandescent task lights behind your computer, those are around 3000K. - I'm a designer / photographer / artist so I can't use f.lux. This isn't for me!
f.lux was created by people who care a lot about accuracy in colors. We know you want to make sure your colors are perfect so there is an option to disable f.lux for 1 hour at a time (for example, while using Photoshop). This setting returns your screen to its normal settings. In the future we plan f.lux Features Crack Key For U allow automatic disabling of f.lux when you launch certain programs. f.lux is not designed for use during advanced color work, but it's fine for layout or HTML.
Installing & Uninstalling
Windows Install
- Click the f.lux Windows download link.
- Run the installer and the f.lux settings page will appear.
- Enter your location and select the type of lighting in your room at night.
Windows Uninstall
- If you find flux.exe running and do not want it:
- Go to the Start Menu > Add/Remove Programs > Uninstall f.lux
Mac Install
- Click the f.lux Mac download link.
- Click the zip file to expand it
- Double click the "Flux" application in your Finder window.
- Enter your location, set your wake time, and select the type of lighting in your room at night.
Mac Uninstall
- Go to the f.lux Settings panel (to the left of your system clock)
- Choose "Quit f.lux"
- In Finder, select and delete the f.lux app, and empty the trash.
If you still have a tinted screen, keep going with these instructions until things improve: - In System Preferences > Displays > Color, delete the "f.lux profile" (if f.lux was force-quit)
- Reboot the system
- Disable automatic brightness, reboot, and turn automatic brightness back on
Linux
Ubuntu-inside.me has written a great guide to using f.lux:
www.ubuntu-inside.me/2009/03/flux-better-lighting-for-your-computer.html
Note: The ubuntu-inside.me site has disappeared but thankfully Archive.org maintains a mirror (linked above) with the original information.
Want to contact us? Email support@justgetflux.com.
Warning: Undefined variable $z_bot in /home/bilincom/public_html/down/office-tools/flux-features-crack-key-for-u.php on line 187
Warning: Undefined variable $z_empty in /home/bilincom/public_html/down/office-tools/flux-features-crack-key-for-u.php on line 187
-
-